Results of a study of parvovirus B19 (Parvoviridae, Parvovirinae, Erythroparvovirus, Primate erythroparvovirus 1) prevalence and circulation activity in socially significant categories of the population

Cover Page


Cite item

Abstract

Currently, along with the increasing need of medical organizations for blood preparations, algorithms for laboratory testing of blood donors are not available for all infections with hemo-contact mechanism of transmission. A representative example is infection caused by parvovirus В19.
Purpose of the study. The article presents the results of the original study, the purpose of which was to study the prevalence of antibodies to parvovirus B19 and the activity of the circulation of this virus in socially important categories of the population.
Material and methods. The materials of the study were blood samples from blood donors of Saint Petersburg, as well as parvovirus В19 sequences isolated from DNA-positive plasma samples.
Results and discussion. According to the results of the laboratory examination, a high proportion of carriers of virus-specific IgG antibodies was found in studied group of donors, which confirms the previous infection of parvovirus B19 in them and illustrates the high prevalence of infection in this socially significant group. Based on the results of the blood preparations testing, the presence of parvovirus DNA В19 in a significant number of samples was determined by polymerase chain reaction method. This indicates an current parvovirus infection in the examined donors and points to a high epidemiological risk of the blood products obtained from them. Sequencing and phylogenetic analysis of a fragment of the VP1 gene demonstrated that the studied isolates belonged to А1 genotype and its subtype 1А2, which correlates with the genotypes of parvovirus В19 circulating in the European Union and Asia. In addition, two previously unknown В19 parvovirus isolates were isolated, the nucleotide sequences of which were deposited into the international GenBank database.
Conclusion. Based on the results of the study, it is justified to include testing of blood samples for markers of В19 parvovirus infection in existing algorithms of laboratory examination of donors, which will ensure prevention of hemo-contact infection of blood recipients with parvovirus В19.

Full Text

Введение

В настоящее время потребность медицинских организаций в препаратах крови значительно возросла, что связано с совершенствованием оказания медицинской помощи населению, особенно с внедрением специализированных высокотехнологичных методов лечения. При этом принципиально важно использование для этих целей сырья, либо полностью освобождённого от гемоконтактных вирусов, либо имеющего минимальную вирусную нагрузку [1][2]. Данное требование закреплено постановлением Правительства РФ от 22.06.2019 № 797 в Правилах заготовки, хранения, транспортировки и клинического использования донорской крови и её компонентов.

Эпидемическая безопасность гемотрансфузий – один из важных компонентов профилактики инфекций, связанных с оказанием медицинской помощи [2]. Предупреждение гемоконтактной передачи возбудителей вирусной природы (гепатиты В, С, D, ВИЧ-инфекция) является её обязательным элементом. В отношении данных инфекций осуществляется эпидемиологический мониторинг и нормативно закреплены алгоритмы лабораторного обследования лиц, являющихся донорами крови. Вместе с тем известны вирусные инфекции, которые могут распространяться посредством гемоконтактного механизма передачи.

К ним относится парвовирусная инфекция человека (ПВИ) В19, впервые обнаруженная Y. Cossart и соавт. при тестировании пробы плазмы крови от здорового донора на вирусный гепатит В [3]. Наименование возбудителя: парвовирус В19 (далее – PV B19) – связано с обозначением лунки лабораторного планшета, где находился исследуемый биологический материал плазмы крови, из которого был выделен патоген.

Гемоконтактный механизм передачи PV В19 особенно актуален для пациентов гематологического и хирургического профиля, являющихся реципиентами препаратов крови. Поэтому с позиции эпидемиологии весьма важно, что устойчивость PV B19 к традиционным режимам дезинфекции (стерилизации) обусловливает эпидемическую опасность продуктов крови, особенно со значительной вирусной нагрузкой (≥10копий/мл), как фактора передачи данной инфекции, способного приводить к заражению до 50% реципиентов [4][5]. Кроме того, известно, что при развитии острой ПВИ в крови появляются нейтрализующие антитела, а собственно период вирусемии, несмотря на сравнительно малую продолжительность (не более 3 нед), сопровождается высокой концентрацией ДНК PV B19 в крови (≥1012 копий/мл) [6]. В свою очередь появление специфических антител класса IgМ к PV B19, циркулирующих в крови до 3 мес, сопряжено со снижением уровня вирусной ДНК, а антитела класса IgG к PV B19, обеспечивающие напряжённый иммунитет, появляются в крови начиная с 14–15-го дня от начала заболевания [7][8]. В связи с этим обнаружение в крови доноров антител того или иного класса может свидетельствовать о наличии или отсутствии острой ПВИ и, соответственно, об уровне эпидемической опасности данной кроводачи.

Таким образом, роль серопозитивных к PV B19 доноров крови в развитии эпидемического процесса ПВИ весьма значима, однако их активное выявление в нашей стране, к сожалению, не предусмотрено. При этом в некоторых странах Европы и в США, в отличие от Российской Федерации, внедрены прямые указания на тестирование крови доноров на PV B19 наряду с возбудителями других гемоконтактных инфекций (гепатиты В, С, D и др.).

Цель исследования – изучение распространённости носительства маркеров гуморального иммунитета и активности циркуляции возбудителей ПВИ среди социально значимых категорий населения (на примере результатов обследования доноров крови, проживающих в Санкт-Петербурге).

Материал и методы

500 образцов плазмы крови доноров из Санкт-Петербурга исследовали на маркеры ПВИ – IgG-антитела и ДНК вируса.

Использовали эпидемиологические (эпидемиологический анализ), математико-статистические, молекулярно-генетические (диагностику методом полимеразной цепной реакции (ПЦР), секвенирование, филогенетический анализ) и серологический (иммуноферментный анализ, ИФА) методы исследования.

Для лабораторной диагностики ПВИ применяли ИФА – стандартный метод определения вирусспецифических антител [9]. Антитела к PV В19 классов IgМ и IgG выявляли с помощью тест-систем «recomWELLParvovirus B19 IgM» и «recomWELLParvovirus B19 IgG» (Microgen GmbH, Германия) в соответствии с инструкцией производителя.

Методом ПЦР с помощью диагностического набора реагентов «АмплиСенс®Parvovirus В19-FL» (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Россия) определяли наличие ДНК PV B19 и вирусную нагрузку положительных образцов плазмы серопозитивных к PV B19 доноров. ДНК для генотипирования выделяли из образцов с наибольшей вирусной нагрузкой.

Выделенную ДНК амплифицировали по методике, описанной ранее [10][11]. Генотипирование проводили по участку (локусу), по которому кодируется фрагмент гена NS1 и область гена VP1 (VP1u) возбудителя, что необходимо для филогенетического анализа изолятов PV B19. Для этого использовали специфические праймеры (ООО «Синтол», Россия), которые подбирали с помощью программы NCBI/PrimerBLAST с учётом данных литературы и в соответствии с общепринятыми рекомендациями.

В работе были использованы праймеры:

ParvoB19 1F CAATTGTCACAGACACCAGTA;
ParvoB19 2F CCCGCGCTCTAGTACGCCCA и ParvoB19 1R ACTTAGCCAGTTGGCTATACCT;
ParvoB19 2R TTGCGGGGGCCCAGCTTGTA.

Секвенирующую реакцию проводили в соответствии с инструкцией к набору реагентов ABI PRISM BigDyeTerminator v3.1 (Applied Biosystems, США) в трёх повторах, на прямых и обратных праймерах. Очищенный осадок денатурировали в формамиде. Продукт секвенирующей реакции анализировали на специальном оборудовании – генетическом анализаторе ABI Prism 3500 (Applied Biosystems, США).

При исследовании генетических элементов использовали программу NCBI Blast с выравниванием последовательностей нуклеотидов посредством программы MEGA 7.0 (алгоритм ClusalW). Полученные результаты сравнивали с международными данными, представленными в GenBank. В филогенетическом анализе методом «присоединения соседей» оценивали расстояние между нуклеотидными последовательностями и строили филогенетическое дерево с учётом критерия сбалансированной эволюции. Кроме того, проведён бутстреп-анализ для 500 доноров, что позволило оценить достоверность построенного филогенетического дерева возбудителя.

Математические расчёты и статистический анализ выполнены с использованием методов, применяемых в медицинских исследованиях. При этом вычисляли частотные показатели и определяли 95% доверительный интервал (ДИ) по методу Вальда–Уилсона.

Результаты

В результате проведённых исследований у 426 (85,2%) обследованных в сыворотках крови были обнаружены вирусспецифические антитела класса IgG. С одной стороны, это свидетельствует о перенесённой ПВИ В19, а с другой – показывает её распространённость в данной социально значимой группе населения (см. таблицу).

IgG-маркеры ПВИ В19 у доноров по гендерным и возрастным признакам, на 100 человек (95% доверительный интервал)
Prevalence of IgG antibodies to parvovirus В19 in donors by gender and age, per 100 people (95% CI)

Как показали результаты исследований, в общей когорте обследованных доноров оказалось 79,4 (95% ДИ 75,6–83,2) мужчин и 5,8 (95% ДИ 3,9–7,7) женщин, серопозитивных к PV В19, на 100 человек. При этом наибольшая частота Ig-маркеров PV В19 выявлена в возрастной группе 18–20 лет: 38,0, особенно среди мужчин (37,0). В то же время среди лиц 40 лет отмечена невысокая распространённость маркеров специфического противовирусного иммунитета: 4,4 у мужчин и 1,8 у женщин на 100 обследованных.

Для определения вирусной нагрузки 426 (85,2%) образцов крови доноров, содержащих IgG-антитела к PV B19, были исследованы методом ПЦР. В результате в 17,4% пробах плазмы крови обнаружена вирусспецифическая ДНК, подтверждающая наличие PV В19 у доноров. При этом отмечена неоднородность вирусной нагрузки: в 13,5% случаев ДНК PV В19 составила 104 копий/мл, в 1,6% – 10–105 и в 2,4% – более 105. С одной стороны, это свидетельствует об острой ПВИ В19, а с другой – об эпидемической опасности таких гемопродуктов, особенно при значительной вирусной нагрузке. Полученный вывод согласуется с данными как отечественных, так и зарубежных исследователей [4][9][12][13].

Была проанализирована частота встречаемости ДНК РV B19 в зависимости от возраста доноров: 18– 20 лет (1-я группа), 21 год – 30 лет (2-я группа), 31 год – 40 лет (3-я группа), 41 год и старше (4-я группа). Анализ показал, что 67,6% положительных проб ПЦР были получены от доноров 1-й группы. Кроме того, в основном у лиц этой группы были обнаружены образцы плазмы крови с высокой вирусной нагрузкой (104–108 копий/мл ДНК РV B19). Среди доноров 2-й группы (21 год – 30 лет) доля лиц с высокой вирусной нагрузкой в клиническом материале составила 28,4%, в 3-й и 4-й возрастных группах – по 2%.

Из образцов плазмы крови с вирусной нагрузкой 106–107копий/мл ДНК PV B19 были выделены два изолята PV B19 – RUS15.15 и RUS15.15.2, их нуклеотидные последовательности депонированы в международную базу данных GenBank: MG779501 и MG779500 соответственно. Полученные последовательности MG779501 и MG779500 оказались идентичными.

При сравнении с референсным изолятом NC000883 из базы GenBank в изолятах RUS 15.15 и RUS 15.15.2 были отмечены изменения качественного состава аминокислот, связанные с мутациями на генном уровне (VP1, VP1u). Выявлены уникальные значимые мутации в следующих последовательностях аминокислот: E14K, V30L, S98N, D107N. Здесь необходимо отметить, что в структурном белке PV B19 (VP1, VP1u) имеется уникальная область, которая является своеобразной антигенной мишенью, нейтрализуемой специфическими антителами. Поэтому происходящие в этой области мутации могут способствовать распространению новых генотипов PV B19 в популяции людей. Однако требуются дополнительные исследования, результаты которых позволят установить эпидемиологическую значимость таких мутаций.

Для филогенетического анализа полученные в данном исследовании нуклеотидные последовательности группировали с последовательностями наиболее широко распространённого в мире генотипа 1А. Генотип 1А включает два клайда: 1А1 и 1А2. По результатам генотипирования обнаруженные изоляты отнесены к подтипу 1А2. Похожие на RUS15.15 и RUS15.15.2 последовательности PV B19 были выделены и депонированы в GenBank из Российской Федерации, из европейских (Франция, Германия) и азиатских стран (Япония), что подтверждает значительную распространённость инфекции, связанной с PV В19 (см. рисунок).


Результаты сравнительного филогенетические анализа выделенных и депонированных в GenBank изолятов парвовируса В19.
Results of comparative phylogenetic analysis of isolated parvovirus В19 sequences deposited in the GenBank.

Обсуждение

К настоящему времени известно три генотипических варианта PV B19, которые на 10–15% различаются по нуклеотидному составу [14][15][16]. При всём разнообразии на генетическом уровне существует только один серотип этого возбудителя [9][17][18]. Эпидемиологическую значимость представляет исследование, направленное на выявление распространённости PV В19 в группе доноров, так как возбудитель может передаваться посредством гемоконтактного механизма, в частности, при использовании препаратов крови и её продуктов. В ходе исследования проб плазмы крови в 85,2% случаев были обнаружены вирусспецифические IgG-антитела, что свидетельствует о перенесённой ПВИ В19. В 14,8% исследованных образцов обнаружена ДНК возбудителя. Нуклеотидная идентичность выделенных из образцов плазмы крови двух изолятов PV B19: RUS15.15 (MG779500) и RUS15.15.2 (MG779501) –  составила 100%, что свидетельствует о циркуляции парвовируса среди обследованных доноров. Изоляты относятся к генотипу G1А2 и имеют уникальные мутации, не представленные ранее в коллекции GenBank.

Как следует из данных литературы, наиболее часто PV B19 инфицируются лица детского и подросткового возраста [19], но, как показывают проведённые исследования, актуальность ПВИ сохраняется и для взрослых лиц, особенно из организованных воинских коллективов.

Заключение

Полученные в исследовании данные показывают необходимость дальнейшей разработки проблемы эпидемической безопасности, связанной с ПВИ В19, в гематологии и трансфузиологии. Одно из её направлений – мониторинг специфической ДНК и вирусной нагрузки (>10копий/мл) в образцах крови, полученной от доноров. Это позволит своевременно отбраковывать эпидемически опасные гемопродукты, что имеет важное практическое значение в профилактике инфекций, связанных с оказанием медицинской помощи. В связи с этим для предупреждения гемоконтактного заражения пациентов PV В19 целесообразно включить в существующие алгоритмы лабораторного обследования доноров тестирование проб крови на маркеры PV В19 (IgМ- и IgG-антитела, ДНК PV В19 с вирусной нагрузкой).

×

About the authors

O. N. Nikishov

S.M. Kirov Military Medical Academy

Author for correspondence.
Email: nikishov.oleg2015@yandex.ru
ORCID iD: 0000-0002-3677-1734

Oleg N. Nikishov, teacher of the Department (general and military epidemiology)

Saint Petersburg, 194044

Russian Federation

A. A. Kuzin

S.M. Kirov Military Medical Academy

Email: fake@neicon.ru
ORCID iD: 0000-0001-9154-7017

Alexander A. Kuzin

Saint Petersburg, 194044

Russian Federation

A. E. Zobov

S.M. Kirov Military Medical Academy

Email: fake@neicon.ru
ORCID iD: 0000-0001-7791-8993

Andrey E. Zobov

Saint Petersburg, 194044

Russian Federation

I. N. Lavrentieva

Saint Petersburg Pasteur Institute

Email: fake@neicon.ru
ORCID iD: 0000-0002-2188-6547

Irina N. Lavrentieva

Saint Petersburg, 197101

Russian Federation

A. Yu. Antipova

Saint Petersburg Pasteur Institute

Email: fake@neicon.ru
ORCID iD: 0000-0002-7763-535X

Anastasiya Yu. Antipova

Saint Petersburg, 197101

Russian Federation

Yu. V. Ostankova

Saint Petersburg Pasteur Institute

Email: fake@neicon.ru
ORCID iD: 0000-0003-2270-8897

Yuliya V. Ostankova

Saint Petersburg, 197101

Russian Federation

I. V. Khamitova

Saint Petersburg Pasteur Institute

Email: fake@neicon.ru
ORCID iD: 0000-0003-1966-7860

Irina V. Khamitova

Saint Petersburg, 197101

Russian Federation

S. N. Nikishov

National Research Mordovian State University named after N.P. Ogarev

Email: fake@neicon.ru
ORCID iD: 0000-0002-1573-6825

Sergey N. Nikishov

Saransk, 430005

Russian Federation

References

  1. Попцов А.Л., Парамонов И.В., Фетищева Н.Ю. Верификация методики выявления и количественного определения ДНК парвовируса В19 методом ПЦР в плазме для фракционирования. Вестник службы крови России. 2014; (1): 48-53.
  2. Элижбаева М.А., Февралева И.С., Глинщикова О.А., Сильвейстрова О.Ю., Шипулина О.Ю., Домонова Э.А. и др. Выявление парвовируса В19 в крови российских доноров. Гематология и трансфузиология. 2011; 56(2): 10-3.
  3. Cossart Y.E., Field A.M., Cant B., Widdows D. Parvovirus-like particles in human sera. Lancet. 1975; 1(7898): 72-3. DOI: http://doi.org/10.1016/s0140-6736(75)91074-0
  4. Парамонов И.В., Попцов А.Л., Рылов А.В. Опыт внедрения системы утверждения доноров плазмы для фракционирования. Гематология и трансфузиология. 2016; 61(2): 87-91. DOI: http://doi.org/10.18821/0234-5730-2016-61-2-87-91
  5. Kleinman S.H., Glynn S.A., Lee T.H., Tobler L., Montalvo L., Todd D., et al. Prevalence and quantitation of parvovirus B19 DNA levels in blood donors with a sensitive polymerase chain reaction screening assay. Transfusion. 2007; 47(10): 1756-64. DOI: http://doi.org/10.1111/j.1537-2995.2007.01341.x
  6. Филатова Е.В., Новикова Н.А., Зубкова Н.В., Голицына Л.Н., Кузнецов К.В. Определение маркеров парвовируса В19 в образцах крови доноров. Микробиология, эпидемиология и иммунология. 2010; (5): 67-70.
  7. Mossong J., Hens N., Friederichs V., Davidkin I., Broman M., Litwinska B., et al. Parvovirus B19 infection in the European countries: seroepidemiology, force of infection, and maternal risk of infection. Epidemiol. Infect. 2008; 136(8): 1059-68. DOI: http://doi.org/10.1017/S0950268807009661
  8. Anderson L.J., Gillespie S.M., Torok T.J., Hurwitz E.S., Tsou C.J., Gary G.W. Risk of infection following exposures to human parvovirus B19. Behring Inst. Mitt. 1990; (85): 60-3.
  9. Anderson L.J., Tsou C., Parker R.A., Chorba T.L., Wulff H., Tattersall P., et al. Detection of antibodies and antigens of human parvovirus B19 by enzyme-linked immunosorbent assay. J. Clin. Microbiol. 1986; 24(4): 522-6.
  10. Лаврентьева И.Н., Антипова А.Ю., Семенов А.В., Бичурина М.А. Генотипы изолятов парвовируса В19, циркулирующих на территории Северо-западного федерального округа России. Журнал микробиологии, эпидемиологии и иммунобиологии. 2013; 90(6): 36-43.
  11. Хамитова И.В., Останкова Ю.В., Антипова А.Ю., Семёнов А.В., Лаврентьева И.Н. Молекулярно-генетическая характеристика изолятов парвовируса В19, циркулирующих на территории северо-западного федерального округа. Журнал микробиологии, эпидемиологии и иммунобиологии. 2018; 95(6): 55-61. DOI: http://doi.org/10.36233/0372-9311-2018-6-55-61
  12. Candotti D., Etiz N., Parsyan A., Allain J.P. Indentification and сharacterization of persistent human erythrovirus infection in blood donor samples. J. Virol. 2004; 78(22): 12169-78. DOI: http://doi.org/10.1128/JVI.78.22.12169-12178.2004
  13. Ke L., He M., Li C., Liu Y., Gao L., Yao F., et al. The prevalence of human parvovirus B19 DNA and antibodies in blood donors from four Chinese blood centers. Transfusion. 2011; 51(9): 1909-18. DOI: http://doi.org/10.1111/j.1537-2995.2011.03067.x
  14. Лаврентьева И.Н., Антипова А.Ю. Парвовирус В19 человека: характеристика возбудителя, распространение и диагностика обусловленной им инфекции. Инфекция и иммунитет. 2013; 3(4): 311-22. DOI: http://doi.org/10.15789/2220-7619-2013-4-311-322
  15. Baylis S.A. Standardization of nucleic acid amplification technique (NAT)-based assays for different genotypes of parvovirus B19: a meeting summary. Vox Sang. 2008; 94(1): 74-80. DOI: http://doi.org/10.1111/j.1423-0410.2007.00992.x
  16. Corcoran A., Doyle S. Advances in the biology, diagnosis and host-pathogen interactionsof parvovirus B19. J. Med. Microbiol. 2004; 53(Pt. 6): 459-75. DOI: http://doi.org/10.1099/jmm.0.05485-0
  17. Blümel J., Eis-Hübinger A.M., Stühler A., Bönsch C., Gessner M., Löwer J. Characterization of Parvovirus B19 genotypes 2 in KU812Ep6 cells. J. Virol. 2005; 79(22): 14197-206. DOI: http://doi.org/10.1128/JVI.79.22.14197-14206.2005
  18. Lou S., Xu B., Huang Q., Zhi N., Cheng F., Wong S., et al. Molecular сharacterization of the newly identified human parvovirus 4 in the family Parvoviridae. Virology. 2012; 422(1): 59-69. DOI: http://doi.org/10.1016/j.virol.2011.09.033
  19. Смеликов Я.А. Парвовирусная (В19) инфекция у детей на современном этапе (обзор). Вестник КГМА им. И.К. Ахунбаева. 2011; (4): 20-4.

Copyright (c) 2020 Nikishov O.N., Kuzin A.A., Zobov A.E., Lavrentieva I.N., Antipova A.Y., Ostankova Y.V., Khamitova I.V., Nikishov S.N.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: серия ПИ № ФС77-77676 от 29.01.2020.


This website uses cookies

You consent to our cookies if you continue to use our website.

About Cookies