Molecular and genetic characteristics of the multicomponent flavi-like Kindia tick virus (Flaviviridae) found in ixodes ticks on the territory of the Republic of Guinea
- Authors: Kartashov M.Y.1, Gladysheva A.V.1, Naidenova E.V.2, Zakharov K.S.2, Shvalov А.N.1, Krivosheina E.I.1, Senichkina A.M.2, Bah M.B.3, Ternovoi V.A.1, Boumbaly S.3, Loktev V.B.1
-
Affiliations:
- State Research Center of Virology and Biotechnology «Vector»
- Russian Research Anti-Plague Institute «Microbe»
- Research Institute of Applied Biology of Guinea
- Issue: Vol 67, No 6 (2022)
- Pages: 487-495
- Section: ORIGINAL RESEARCHES
- URL: https://virusjour.crie.ru/jour/article/view/661
- DOI: https://doi.org/10.36233/0507-4088-145
- ID: 661
Cite item
Abstract
Introduction. Ixodes ticks are vectors for pathogens of many infectious diseases. Recently, during the study of Rhipicephalus geigyi ticks collected from livestock in the Republic of Guinea, a new multicomponent flavi-like RNA virus, called Kindia tick virus (KITV), was discovered with an unusual mechanism for the implementation of genetic information.
The aim of the work is to detect and study the genetic diversity of KITV in ixodes ticks collected in the territory of the Kindia province of the Republic of Guinea.
Material and methods. In 2021, 324 specimens of ticks of the species Amblyomma variegatum, Rh. geigyi, Rh. annulatus, Rh. decoloratus, Rh. senegalensis were collected from cattle. The detection of viral RNA was carried out in individual samples of ticks by RT-PCR, followed by the determination of the nucleotide sequence and phylogenetic analysis.
Results and discussion. KITV detection rates in ticks of the species Rh. geigyi was 12.2%, Rh. annulatus – 4.4%, Rh. decoloratus – 3.3%. However, the KITV genetic material has not been identified in Am. variegatum ticks, which are one of the dominant species in West Africa. For all virus isolates, a partial nucleotide sequences of each of the four viral segments (GenBank, OK345271–OK345306) were determined. The phylogenetic analysis showed a high level of identity (98.5–99.8%) for each of the four segments of the viral genome with those previously found in the Republic of Guinea. The obtained KITV isolates are most genetically close to Mogiana tick virus, which was previously detected in South America in Rh. microplus ticks and significantly differed from other multicomponent viruses circulating in Europe and Asia, including the Russian Federation.
Conclusion. KITV genetic material was found in three species of ixodid ticks collected from livestock in a number of prefectures of the Republic of Guinea. The infection rate in ticks was 3.3–12.2%. The continuation of research in this direction remains relevant.
Full Text
Introduction
Outbreaks in the past few decades give a new perspective on emerging and re-emerging infectious viral diseases. Quintessential examples of emergency situations representing the danger of such infections can be seen in avian influenza H5N1 and Zika fever epidemics as well as in the ongoing pandemic of novel coronavirus infection COVID-19 caused by the SARS-CoV-2 virus. These infectious diseases owe their emergence to the secondary or cross-species transmission of viral agents from their natural hosts to humans [1].
At the same time, some researchers have found that various viruses representing different families build the virus-host relationship, following certain patterns. Representatives of the family Flaviviridae demonstrate multiple examples of such interactions [2–4]. For example, dengue, Zika or yellow fever viruses are transmitted by mosquitoes, the tick-borne encephalitis virus is transmitted by ticks, while the hepatitis C virus is not transmitted by arthropod vectors.
Recently, new flavi-like viruses have been discovered. One of them is the Jingmen tick virus (JMTV) that was first isolated from Rhipicephalus microplus ticks collected in Hubei province in China and was named after the area where it was found – the Jingmen Region [5]. Almost at the same time, a similar multicomponent flavivirus, the Guaico Culex virus (GCXV), was detected in mosquitoes of the genus Culex in Peru, Panama, and and Trinidad in the Caribbean Sea in the Caribbean Sea [5, 6].
In addition to ectoparasites, genetic material of the JMTV virus (RC27) was also detected in plasma of primates – red colobus monkeys (the genus Piliocolobus (Rochebrune, 1877)) living in Uganda as well as in sera collected from cattle and rodents [5–8]. JMTV is believed to be responsible for the outbreaks of febrile illness in China and Kosovo [7, 9, 10]. The above findings led to conclusion that the virus was able to cross the species barrier and effectively replicate both in ectoparasites and in warm-blooded animals.
The later studies of different species of arthropods and vertebrates discovered other multicomponent flavi-like viruses having the genome structure and genetic information transmission mechanism similar to JMTV. For example, the Mogiana tick virus (MGTV) was isolated from salivary glands of the Rh. microplus tick in Brazil [11]. Later, the circulation of the previously unknown Alongshan (ALSV) virus was discovered in Northeast China. Shortly after, this pathogen was isolated from Ixodes ricinus ticks (Linnaeus, 1758) in the southeast of Finland and in some regions of Russia [12, 13]. Multicomponent flavi-like viruses were also found in Turkey in Rh. sanguineus sensu lato (Latreille, 1806), R. turanicus (Pomerantsev, 1936), R. bursa (Canestrini & Fanzago, 1878), Hyalomma marginatum (Koch, 1844), Haemaphysalis inermis (Birula, 1895), Ha. parva (Neumann, 1897) ticks [14]. The similar multicomponent virus was detected in blood of Crimean-Congo hemorrhagic fever (CCHF) patients in Kosovo and in the south of Russia [15].
The genome structure in all flavi-like viruses is characterized by segmentation and existence of genes encoding two major non-structural viral proteins, which are related to proteins of representatives of the family Flaviviridae (NS3 and NS5); however, multicomponent viruses have genomes with 4 (typical of most of the viruses isolated from ticks, bats, monkeys, and humans) or 5 (as in viruses isolated from mosquitoes) segments, which are flanked at 5′ and 3′ ends by non-translated regions, and are polyadenylated (Fig. 1). Segment 1 encodes the non-structural NS5-like protein having homology with the NS5 protein (RNA-dependent RNA polymerase) of classical representatives of the family Flaviviridae. Segment 3 encodes the non-structural protein having high homology with the flavivirus NS3 protein. The NS3 protein, along with NS5, plays the central role in replication of the virus and is one of the best-studied non-structural proteins. The NS3 N-terminal domain has protease activity, which is essential for polyprotein processing, while the C-terminal domain performs the function of helicase and is involved in viral RNA capping and synthesis. The structure of the NS3 protein has been thoroughly studied in most of the non-segmented flaviviruses, and their analysis shows high homology not only in the structure, but also in mechanisms of ATP hydrolysis, RNA recognition and unwinding [16]. Structural proteins VP1, VP2, and VP3 are encoded in the second and fourth fragments and do not have any known homologs both among flaviviruses and among other identified viruses. Segment 2 encodes putative glycoprotein VP1. Proteins VP2 (putative capsid protein) and VP3 (putative viral membrane protein) are encoded in segment 4 and have partially overlapping reading frames [14]. Some researchers have conducted a few serological studies based on VP1 and VP2 structural proteins to analyze the circulation of specific antibodies in sera from sheep and cattle, which are feeders of arthropod vectors [17], or from patients with tick bite history [12].
Fig. 1. Scheme of the structure of the genome of multicomponent flavi-like viruses on the example of KITV.
Рис. 1. Схема строения генома многокомпонентных флавиподобных вирусов на примере KITV.
Today, the pathogenicity of multicomponent flavi-like viruses has been proven for livestock animals and humans. However, the available information is fragmentary and limited. It is quite possible that their role in infectious pathology can be more significant than it is commonly believed. The evidence that multicomponent flavi-like viruses are well represented and are detected in Asia, Europe, Africa, and America necessitates further studies of this group of pathogens.
There are grounds to believe that tick-borne flaviviruses originated in Africa from the Kadam-like virus (KADV) approximately 28.5 thousand years ago. Subsequently, they spread in Europe, Asia, and America. There is a strong possibility that African multicomponent flaviviruses such as the Kindia tick virus (KITV) are the most likely candidates for predecessors of modern representatives of this group of pathogens [18].
The multicomponent flavi-like virus tentatively named the Kindia tick virus was first isolated in Guinea during the metagenomic studies; it was isolated from suspensions of Rh. geigyi ticks collected from cattle in the Kindia Region [15, 19]. It was found that KITV had the highest homology with MGTV isolated from Rh. microplus ticks in South America.
The difference between KITV nucleotide/amino acid sequences and sequences of other representatives of segmented flavi-like viruses was 7–28/3.1–21.8% (for segment 1); 7.7–20.6/3.4–20.3% (for segment 2); 2.3–29.3/1.3–20.8% (for segment 3), and 0.4–22/0.2–15% (for segment 4).
The purpose of this study was the further search and molecular-genetic characterization of multicomponent flavi-like viruses in ixodid ticks collected in Guinea.
Materials and methods
The tests were conducted at the laboratory of the Russian-Guinean Center for Epidemiology and Prevention of Infectious Diseases, which is located at the site of the Research Institute of Applied Biology in Kindia, the Republic of Guinea [20].
Ticks were collected from April to May in 2021 during the examination of adult free-grazing livestock animals in Coyah, Dubreka, Forecariah, Kindia, Telimele prefectures in the Kindia Region (Fig. 2). The collected and pre-treated material was tested using the polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) with reagent kits manufactured in Russia to detect pathogen markers: AmliSens CCHFV-FL for CCHF virus RNA; AmpliSens TBEV, B. burgdorferi sl, A. phagocytophilum, E. chaffeensis / E. muris-FL for cDNA of the tick-borne encephalitis virus, Borrelia burgdorferi sl, Ehrlichia chaffeensis / E. muris and DNA Anaplasma phagocytophilum; AmpliSens Coxiella burnetii-FL for DNA Coxiella burnetii, the AmpliSens Rickettsia spp. SFG-FL reagent kit for DNA of the Rickettsia of the tick-borne spotted fever Rickettsia spp. group (Central Research Institute of Epidemiology, Russia) as well as the Gene Francisella tularensis-RGF for Francisella tularensis DNA (Microbe Russian Research Anti-Plague Institute, Russia). Samples without the above pathogens were selected for the further studies.
Fig. 2. Territories of Kindia Prefecture (Republic of Guinea) where samples were collected for research. Tick collection sites are marked with asterisks.
Рис. 2. Территории префектуры Киндиа (Гвинейская Республика), где были собраны пробы для исследований. Места сбора клещей обозначены звездочками.
A total of 324 individual samples of ticks belonging to species Am. variegatum, Rh. geigyi, Rh. annulatus, Rh. decoloratus, and Rh. Senegalensis were collected, prepared, and analyzed for the study. Ectoparasites were washed twice with 70% ethanol to remove external impurities and microflora; they had been stored at –20 °C before they were used in the further tests. Tick species were identified by morphological characteristics in accordance with the identification guide [21] using a binocular with magnification ×56 and subsequent taxonomic verification of the nucleotide sequence of the ribosomal RNA gene fragment.
The analyzed samples were prepared using the TissueLyser II laboratory homogenizer (QIAGEN, Germany) in 500 μl of sterile phosphate buffered saline. Viral RNA was extracted from 100 μl of tick suspension using phenol/chloroform extraction and the ExtractRNA™ Reagent kit (Evrogen, Russia). cDNA was produced by the reverse transcription reaction using the RЕVERTA-L commercial kit (AmpliSens, Russia) in accordance with the manufacturer’s instructions.
The tested samples were screened for the presence of KITV genetic material using PCR and the pair of KITV1_bF/KITV1_bR primers complementary to segment 1 (the NS5-like gene, segment 1) (Table 1). Amplicons partially overlapping all 4 segments of the KITV genome were obtained for positive samples. The amplification reaction was performed in 25 μl of reaction mixture containing 12.5 μl of 2X PCR master mix (BioLabMix, Russia), 0.2 μM of each primer and 1.5 μl of cDNA. The primers used in the study and the expected amplicon length are shown in Table 1. RT-PCR was performed in the T100 thermocycler (BioRad, United States) following the amplification protocol: activation of polymerase at 95 °C for 5 min; then 38 successive cycles: denaturation at 95 °C for 15 sec, annealing of primers at 57 °C for 20 sec, elongation at 72 °C for 45 sec, final elongation at 72 °C for 5 min. The reaction products were analyzed using electrophoresis in 2% agarose gel containing ethidium bromide at concentration of 2 μg/ml.
Table 1. Oligonucleotide primer used in the work
Таблица 1. Последовательности олигонуклеотидных праймеров, используемых в работе
Target gene Ген-мишень | Primer Праймер | Primer sequence Структура праймера | T annealing, °C Температура отжига, °C | Amplicon length, bp Длина ампликона, п.н. |
Internal transcribed spacer 2 | Boophits 2F | GCCGTCGACTCGTTTTGA | 57 | 825 |
Boophits 2R | TCCGAACAGTTGCGTGATAAA | |||
KITV Segment 1 Сегмент 1 | KITV1_aF | TGAAGAACGTCAAGCCCTGG | 58 | 602 |
KITV1_aR | GCTGACCCACGAACCTGTTT | |||
KITV1_bF | AAAGAAGGGCTCTGAGGGC | 58 | 607 | |
KITV1_bR | CTTATACAGGCCCTGTCCCG | |||
KITV1_cF | GAAGTGCGGATGGAGCGTAG | 58 | 619 | |
KITV1_cR | ACCTGTGGGAGCAGAAGGAT | |||
KITV Segment 2 Сегмент 2 | KITV2_aF | AACTTTGGGAGTGACCAGGG | 58 | 617 |
KITV2_aR | GATAAGGCCGTCAGAGCGAG | |||
KITV2_bF | CAGGGACGAGACATTGCCAA | 58 | 555 | |
KITV2_bR | CCGTGGAGTAGTGGACCGTA | |||
KITV Segment 3 Сегмент 3 | KITV3_aF | AATTGGAGAGGCAGAGGGGA | 58 | 609 |
KITV3_aR | GACCTTGTTGGACCAGGTCA | |||
KITV3_bF | GGCAACTCATGACCTGGTCC | 58 | 558 | |
KITV3_bR | AGGACCACTGTGGCGTAGT | |||
KITV Segment 4 Сегмент 4 | KITV4_aF | CCCTACCAGGCCTGATACGA | 58 | 615 |
KITV4_aR | TAGTAGCGGGCCAGGTTGTA | |||
KITV4_bF | GCGGAGAGAGAGAAAACGCA | 58 | 617 | |
KITV4_bR | ACAGGTTCACGAACACAGCC |
Nucleotide sequences of the PCR fragments were determined with the help of the ABI PRISM® BigDye™ Terminator v3.1 regent kit (ThermoFisher Scientific, United States) and then analyzed using the ABI PRISM 3130 sequencer (Applied Biosystems, United States). The obtained chromatograms were analyzed using the SeqMan program (DNAstar, United States).
The phylogenetic analysis was conducted using Mega X software, the maximum likelihood method and the Tamura 1992 (T92) three-parameter evolutionary model [22]. Statistical reliability of nodes of the phylogenetic tree was assessed with the bootstrap method for 1000 repetitions.
The partial nucleotide sequences of segments of KITV isolates detected in this study were deposited to GenBank database with accession numbers OK345271–OK345279 – for segment 1, OK345280 – OK345288 – for segment 2, OK345289–OK345297 – for segment 3, OK345298–OK345306 – for segment 4.
Authors confirm compliance with institutional and national standards for the use of laboratory animals in accordance with CONSENSUS AUTHOR GUIDELINES FOR ANIMAL USE (IAVES 23 JULY 2010).
Results and discussion
During the study, KITV RNA was detected in 9 samples. Partial nucleotide sequences of each segment were identified for all isolates: segment 1 – 1609 base pairs (bp), segment 2 – 980 bp, segment 3 – 1114 bp and segment 4 – 1116 bp. It was found that differences in nucleotide and amino acid sequences of KITV compared to other representatives of segmented flavi-like viruses were as follows: for segment 1 – from 7 to 28% and from 3.1 to 21.8%; for segment 2 – from 7.7 to 20.6% and from 3.4 to 20.3%; for segment 3 – from 2.3 to 29.3% and from 1.3 to 20.8% and for segment 4 – from 0.4 to 22% and from 0.2 to 15%, respectively (Table 2).
Table 2. Detection of KITV RNA among different species of ticks by RT-PCR
Таблица 2. Выявление РНК KITV среди разных видов иксодовых клещей методом ОТ-ПЦР
Species of ticks Вид клеща | Number of samples (of which positive) Количество экземпляров (из них положительных) | Prevalence of KITV Встречаемость KITV |
Am. variegatum | 197 (0) | 0% (95% CI 0–1.9) |
Rh. geigyi | 49 (6) | 12.2% (95% CI 5.7–24.2) |
Rh. annulatus | 45 (2) | 4.4% (95% CI 1.2–14.8) |
Rh. decoloratus | 30 (1) | 3.3% (95% CI 0.7–16.1) |
Rh. senegalensis | 3 (0) | 0% (95% CI 0–46.2) |
Всего Total | 324 (9) | 2.8% (95% CI 1.5–5.1) |
The homology of nucleotide sequences isolated in 2021 for segment 1 was 98.5–100%; for segment 2 – 99.6–100%; for segments 3 and 4 – 99.5–100%. When compared with the KITV/2017/1 isolate obtained in 2017, the homology level was 98.7–99.2%; compared to other multicomponent flavi-like viruses, it ranged from 72 to 90% for fragment 1; from 60 to 90% – for fragment 2; from 73 to 90% – for fragment 3 and from 61 to 90% – for fragment 4.
Fig. 3 shows that all the sequences isolated in 2021 are clustered into one group together with the KITV/2017/1 isolate [18]. It is noteworthy that the phylogenetic trees of the detected isolates of KITV and other multicomponent viruses, which were constructed for each segment, have almost identical topology. In 2021, KITV was found in three species of ixodid ticks, but the sequences were quite conserved, and no significant differences associated with the taxonomic difference among ectoparasites were found.
Fig. 3. Phylogenetic analysis of KITV isolates from individual ixodid ticks for all four genome segments.
Рис. 3. Филогенетический анализ изолятов KITV из индивидуальных иксодовых клещей для всех четырёх сегментов генома.
Some researchers have reported that multicomponent flavi-like viruses are subdivided into at least three subclades [23]. The analysis of each of the four genome segments shows that the KITV virus and its identified isolates are explicitly clustered into subclade A that also includes MGTV (Brazil), JMTV (China, Asia) and JMTV/primate/Uganda variant (Africa). Subclade B includes JMTV isolates from the Antilles and JMTV/human/Kosovo variants (MH133313–MH133316) isolated from CCHF patients. Subclade C is comprised of JMTV isolates from France (MN095527–MN095530) and the Alongshan virus detected in domestic animals and humans in China and during later years in Europe and Russia.
It can be assumed that redistribution/recombination events are typical of viruses with a multicomponent genome, contributing to their genetic variation. However, the available data suggest that the JMTV genome is exceptionally stable among vertebrates and invertebrates, thus leading to the conclusion that the virus has been well adapted to both hosts. Nucleotide sequences of different segments of representatives of this group demonstrate a high level of homology among geographically distanced viruses circulating in Europe, Asia, Africa, and South America. The genome analysis does not provide the possibility to identify apparent mutations, which could capture the adaptation of the virus to the vertebrate or invertebrate host. The genome conservation may be associated with the long-range spread of the same virus. The clear picture of such wide scale spread of the virus can be obtained through studies of the role played by migratory birds, rodents and, possibly, bats.
Conclusion
The study has found that the Kindia tick virus is the first segmented flavi-like virus detected in West Africa. The KITV genetic material was obtained from Rh. geigyi, Rh. annulatus and Rh. decoloratus ixodid ticks collected from domestic livestock; the infection rate was 3.3–12.2%. The phylogenetic analysis of four fragments KITV showed a high level of homology (98.5–100%) with the previously detected isolates isolated in Guinea in 2017 and made it possible to cluster them into subclade A of JMTV-like viruses.
Thus, the obtained results demonstrate the importance of further studies of the KITV circulation in West Africa, identification of species of reservoirs/vectors and assessment of the pathogenicity for humans and animals.
About the authors
Mikhail Yu. Kartashov
State Research Center of Virology and Biotechnology «Vector»
Email: mikkartash@yandex.ru
ORCID iD: 0000-0002-7857-6822
PhD, MD (Biology), Senior Researcher, Department of Flavivirus Infections
Russian Federation, 630559, Koltsovo, Novosibirsk regionAnastasia V. Gladysheva
State Research Center of Virology and Biotechnology «Vector»
Email: mikkartash@yandex.ru
ORCID iD: 0000-0002-7396-3954
Junior Researcher, Department of Flavivirus Infections
Russian Federation, 630559, Koltsovo, Novosibirsk regionEkaterina V. Naidenova
Russian Research Anti-Plague Institute «Microbe»
Email: katim2003@mail.ru
ORCID iD: 0000-0001-6474-3696
PhD, MD (Biology), Senior Researcher, Laboratory of Virology, Department of Infectious Diseases Diagnostics
Russian Federation, 410005, SaratovKirill S. Zakharov
Russian Research Anti-Plague Institute «Microbe»
Email: mikkartash@yandex.ru
ORCID iD: 0000-0002-4726-309X
PhD, MD (Biology), Senior Researcher
Russian Federation, 410005, SaratovАlexander N. Shvalov
State Research Center of Virology and Biotechnology «Vector»
Email: mikkartash@yandex.ru
ORCID iD: 0000-0001-6890-1575
PhD (Physics and Mathematics), Senior Researcher
Russian Federation, 630559, Koltsovo, Novosibirsk regionEkaterina I. Krivosheina
State Research Center of Virology and Biotechnology «Vector»
Email: katr962@mail.ru
ORCID iD: 0000-0001-5181-0415
Junior Researcher, Department of Flavivirus Infections
Russian Federation, 630559, Koltsovo, Novosibirsk regionAislu M. Senichkina
Russian Research Anti-Plague Institute «Microbe»
Email: mikkartash@yandex.ru
PhD, (Biology), Senior Researcher, Department of Infectious Diseases Diagnostics
Russian Federation, 410005, SaratovMamadou B. Bah
Research Institute of Applied Biology of Guinea
Email: mikkartash@yandex.ru
ORCID iD: 0000-0002-4565-269X
postgraduate student
Guinea, KindiaVladimir A. Ternovoi
State Research Center of Virology and Biotechnology «Vector»
Email: tern@vector.nsc.ru
ORCID iD: 0000-0003-1275-171X
PhD, MD (Biology), head of the laboratory Department of Flavivirus Infections
Russian Federation, 630559, Koltsovo, Novosibirsk regionSanaba Boumbaly
Research Institute of Applied Biology of Guinea
Email: drboumbaly@yahoo.fr
ORCID iD: 0000-0002-4506-6033
PhD, chief graduate school Research Institute of Applied Biology
Guinea, KindiaValery B. Loktev
State Research Center of Virology and Biotechnology «Vector»
Author for correspondence.
Email: loktev@vector.nsc.ru
ORCID iD: 0000-0002-0229-321X
Doctor of Biology, Head of Department of Flavivirus Infections
Russian Federation, 630559, Koltsovo, Novosibirsk regionReferences
- Karesh W.B., Dobson A., Lloyd-Smith J.O., Lubroth J., Dixon M.A., Bennett M., et al. Ecology of zoonoses: natural and unnatural histories. Lancet. 2012; 380(9857): 1936–45. https://doi.org/10.1016/s0140-6736(12)61678-x
- Gaunt M.W., Sall A.A., Lamballerie X., Falconar A.K.I., Dzhivanian T.I., Gould E.A. Phylogenetic relationships of flaviviruses correlate with their epidemiology, disease association and biogeography. J. Gen. Virol. 2001; 82(Pt. 8): 1867–76. https://doi.org/10.1099/0022-1317-82-8-1867
- Kitchen A., Shackelton L.A., Holmes E.C. Family level phylogenies reveal modes of macroevolution in RNA viruses. Proc. Natl Acad. Sci. USA. 2011; 108(1): 238–43. https://doi.org/10.1073/pnas.1011090108
- Blitvich B.J., Firth A.E. Insect-specific flaviviruses: a systematic review of their discovery, host range, mode of transmission, superinfection exclusion potential and genomic organization. Viruses. 2015; 7(4): 1927–59. https://doi.org/10.3390/v7041927
- Qin X.C., Shi M., Tian J.H., Lin X.D., Gao D.Y., He J.R., et al. A tick-borne segmented RNA virus contains genome segments derived from unsegmented viral ancestors. Proc. Natl Acad. Sci. USA. 2014; 111(18): 6744–9. https://doi.org/10.1073/pnas.1324194111
- Ladner J.T., Wiley M.R., Beitzel B., Auguste A.J., Dupuis A.P. 2nd, Lindquist M.E., et al. A multicomponent animal virus isolated from mosquitoes. Cell Host Microbe. 2016; 20(3): 357–67. https://doi.org/10.1016/j.chom.2016.07.011
- Emmerich P., Jakupi X., von Possel R., Berisha L., Halili B., Günther S., et al. Viral metagenomics, genetic and evolutionary characteristics of Crimean-Congo hemorrhagic fever orthonairovirus in humans, Kosovo. Infect. Genet. Evol. 2018; 65: 6–11. https://doi.org/10.1016/j.meegid.2018.07.010
- Yu Z.M., Chen J.T., Qin J., Guo J.J., Li K., Xu Q.Y., et al. Identification and characterization of Jingmen tick virus in rodents from Xinjiang, China. Infect. Genet. Evol. 2020; 84: 104411. https://doi.org/10.1016/j.meegid.2020.104411
- Jia N., Liu H.B., Ni X.B., Bell-Sakyi L., Zheng Y.C., Song J.L., et al. Emergence of human infection with Jingmen tick virus in China: A retrospective study. EBioMedicine. 2019; 43: 317–24. https://doi.org/10.1016/j.ebiom.2019.04.004
- Wang Z.D., Wang B., Wei F., Han S.Z., Zhang L., Yang Z.T., et al. A New Segmented Virus Associated with Human Febrile Illness in China. N. Engl. J. Med. 2019; 380(22): 2116–25. https://doi.org/10.1056/nejmoa1805068
- Maruyama S.R., Castro-Jorge L.A., Ribeiro J.M., Gardinassi L.G., Garcia G.R., Brandão L.G., et al. Characterisation of divergent flavivirus NS3 and NS5 protein sequences detected in Rhipicephalus microplus ticks from Brazil. Mem. Inst. Oswaldo Cruz. 2014; 109(1): 38–50. https://doi.org/10.1590/0074-0276130166
- Kuivanen S., Levanov L., Kareinen L., Sironen T., Jääskeläinen A.J., Plyusnin I., et al. Detection of novel tick-borne pathogen, Alongshan virus, in Ixodes Ricinus ticks, south-eastern Finland, 2019. Euro Surveill. 2019; 24(27): 1900394. https://doi.org/10.2807/1560-7917.es.2019.24.27.1900394
- Kholodilov I.S., Litov A.G., Klimentov A.S., Belova O.A., Polienko A.E., Nikitin N.A., et al. Isolation and characterisation of Alongshan virus in Russia. Viruses. 2020; 12(4): 362. https://doi.org/10.3390/v12040362
- Dinçer E., Hacıoğlu S., Kar S., Emanet N., Brinkmann A., Nitsche A., et al. Survey and characterization of Jingmen tick virus variants. Viruses. 2019; 11(11): 1071. https://doi.org/10.3390/v11111071
- Ternovoy V.A., Gladysheva A.V., Sementsova A.O., Zaykovskaya A.V., Volynkina A.S., Kotenev E.S., et al. Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia. Vestnik Rossiyskoy akademii meditsinskikh nauk. 2020; (2): 116–21. https://doi.org/10.15690/vramn1192 (in Russian)
- Gao X., Zhu K., Wojdyla J.A., Chen P., Qin B., Li Z., et al. Crystal structure of the NS3-like helicase from Alongshan virus. IUCrJ. 2020; 7(Pt 3): 375–82. https://doi.org/10.1107/s2052252520003632
- Wang Z.D., Wang W., Wang N.N., Qiu K., Zhang X., Tana G., et al. Prevalence of the emerging novel Alongshan virus infection in sheep and cattle in Inner Mongolia, northeastern China. Parasit. Vectors. 2019; 12(1): 450. https://doi.org/10.1186/s13071-019-3707-1
- Henderson B.E., Tukei P.M., McCrae A.W., Ssenkubuge Y., Mugo W.N. Virus isolations from Ixodid ticks in Uganda. II. Kadam virus – a new member of arbovirus group B isolated from Rhipicephalus pravus Dontiz. East Afr. Med. J. 1970; 47(5): 273–6.
- Ternovoi V.A., Protopopova E.V., Shvalov A.N., Kartashov M.Yu., Bayandin R.B., Tregubchak T.V., et al. Complete coding genome sequence for a novel multicomponent Kindia tick virus detected from ticks collected in Guinea. bioRxiv. 2020. Preprint. https://doi.org/10.1101/2020.04.11.036723
- Naydenova E.V., Lopatin A.A., Safronov V.A., Kolomoets E.V., Levkovskiy A.E., Silla A.L., et al. Biological safety at carrying out anti-epidemic measures during the liquidation of the epidemic Ebola fever in the Republic of Guinea. Infektsionnye bolezni: novosti, mneniya, obuchenie. 2018; 7(3): 102–8. https://doi.org/10.24411/2305-3496-2018-13015 (in Russian)
- Walker A.R., Bouattour A., Camicas J.L., Agustin Estrada-Peña A., Horak I., Latif A.A., et al. Ticks of Domestic Animals in Africa: A Guide to Identification of Species. Edinburgh: Bioscience Reports; 2003.
- Kumar S., Stecher G., Li M., Knyaz C., Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018; 35(6): 1547–9. https://doi.org/10.1093/molbev/msy096
- Temmam S., Bigot T., Chrétien D., Gondard M., Pérot P., Pommelet V., et al. Insights into the host range, genetic diversity, and geographical distribution of Jingmenviruses. mSphere. 2019; 4(6): e00645-19. https://doi.org/10.1128/msphere.00645-19
Supplementary files





