The influence of cultivation parameters on the reproduction of recombinant influenza viruses expressing immunodominant proteins of Mycobacterium bovis

Full Text

Introduction

The influenza A virus is widely used as a vector platform for the development of recombinant vaccines due to its high immunogenicity, its ability to induce a robust humoral and cellular immune response, and the possibility of targeted genetic modification of its segmented genome [1, 2]. The surface glycoprotein–hemagglutinin–plays a key role in the formation of a protective immune response by facilitating the virus’s binding to host cell receptors and serving as the primary target for neutralizing antibodies. The antigenic structure of hemagglutinin is characterized by the presence of immunodominant regions prone to antigenic drift, which necessitates the constant updating of vaccine strains [3]. Influenza vectors are successfully used to express foreign antigens from various pathogens, including causative agents of bacterial infections; in this context, the induction of a Th1-type immune response–which is critically important for protection against tuberculosis–is of particular significance [4, 5].

In recent years, the use of the influenza A virus as a vector for delivering protective antigens of Mycobacterium tuberculosis and M. bovis, including ESAT-6 and TB10.4, has shown promise. Experimental studies have demonstrated that recombinant influenza vectors expressing these antigens have a favorable safety profile and provide a protective effect in model systems, including mice, guinea pigs, and farm animals [5–7]. This confirms the feasibility of further developing this vaccine platform for the prevention of tuberculosis in cattle.

However, the insertion of foreign mycobacterial genes into the influenza virus genome may affect its biological properties. It is known that changes in the structure of the influenza virus genome can affect replicative activity, genetic stability, and the rate of infectious particle production, which is associated with the mutation burden and limitations of the virus’s replicative machinery [6, 8]. Despite the relative mutational stability of the influenza A virus, the expression of foreign antigens can reduce the viral titer and complicate the scaling-up process [8]. In this regard, optimizing the culture conditions for recombinant strains is an essential step in their technological and biological characterization.

Influenza viruses are cultured on various substrates, including chicken embryos and cell cultures; cultivation parameters–temperature, cell density, medium composition, and incubation duration–have a significant impact on the efficiency of viral replication [9–11]. Recent studies demonstrate the effectiveness of a systematic approach to optimizing culture conditions, including Design of Experiments (DoE) methods, which allow for the identification of optimal combinations of parameters to increase viral yield and viral protein expression [12].

The efficacy of recombinant influenza virus cultivation and their infectivity are traditionally assessed using classical titration methods, including the determination of the 50% infectious dose (TCID₅₀) by the Reed–Muench method, which ensures the reproducibility and comparability of results across different studies [13]. Given the previously described molecular biological characteristics of influenza vector strains expressing mycobacterial antigens [6], a targeted study and optimization of their cultivation conditions are key factors in obtaining stable preparations.

The aim of this study is to investigate the optimal cultivation parameters for recombinant influenza A virus strains expressing the ESAT-6 and TB10.4 antigens of M. bovis that yield the maximum amount of infectious virus while maintaining the genetic stability of the inserts. This study represents an important step in the development of effective and safe vector vaccines for further preclinical and production studies.

Materials and methods

This study utilized recombinant influenza A viruses engineered using reverse genetics and carrying genes for immunodominant M. bovis proteins integrated into the influenza virus genome. Sequences encoding mycobacterial antigens were cloned into the viral vector genome, and their expression was controlled by viral regulatory elements active in infected cells [14]. For the cultivation of recombinant influenza viruses, subcultured Madin–Darby Canine Kidney (MDCK) and Vero cell lines (European Cell Culture Collection) were used, adapted to grow in serum-free OptiPro medium (Gibco, USA) supplemented with 2% GlutaMax culture supplement (Gibco, USA), maintained in Dulbecco’s Modified Eppendorf Medium (DMEM) with 4 mM L-glutamine and antibiotics (penicillin, streptomycin). Cells were cultured at 37 °C in a 5% CO₂ atmosphere. Prior to infection, the cells were washed with phosphate-buffered saline and transferred to a maintenance medium containing trypsin (TRSC-treated) at a concentration optimal for the activation of viral hemagglutinin. Cell infection was performed using the recombinant viruses A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4 at a dose of 1,000 log₁₀ TCID₅₀/cm³ at an average temperature of 37 ± 0.5 °C. The infected cell cultures were then incubated at temperatures of 30 ± 0.5, 35 ± 0.5, and 37 ± 0.5 °C and a relative humidity of 55 ± 5%.

Culture conditions were optimized by varying the following parameters: incubation temperature (33 ± 0.5, 35 ± 0.5, 37 ± 0.5 °C), trypsin concentration in the medium, culture duration (24, 48, and 72 h), and cell line type.

The biological activity of the recombinant strains A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4 was determined using a standard method by titration in Vero and MDCK cell cultures. Titration results were calculated according to the method of L. Reed and H. Muench and expressed in log₁₀ TCID₅₀/cm³. The cytopathic effect of the recombinant viral strains on Vero cell cultures after transfection was assessed visually using a Leitz Diavert 10× inverted phase-contrast microscope (Ernst Leitz GmbH, Germany). The hemagglutination activity of the recombinant strains was determined using a standard method via a hemagglutination inhibition assay (HAI) with a 1% suspension of rooster erythrocytes.

To confirm the presence of the insert, the NS gene was amplified using reverse transcription polymerase chain reaction (RT-PCR) (OneTaq One-Step RT-PCR kit, New England Biolabs, USA), and its size was determined by comparison with the wild-type strain of influenza A/chicken/Astana/6/05 (H5N1) virus, which lacks inserts. RNA extraction and one-step RT-PCR were performed using the primers NS-RT-Len (forward primer) – AGCAAAAGCAGGGTGACAAAG; PR8-NS1-3UTR (reverse primer) – GAAACAAGGGTGTTTTTTATTATTAAAT, were performed according to a standard protocol.

All experiments were performed in at least 3 independent replicates. The results are presented as the mean ± standard deviation (M ± SD) using Student’s t-test; differences were considered statistically significant at p < 0.05.

The study protocol was approved by the Ethics Committee of the Research Institute for Biological Safety Issues (Protocol No. 10 dated September 28, 2020).

Results

Recombinant viral strains were generated by transfecting Vero cells with a set of 8 plasmids (Fig. 1). In this system, each plasmid contains a cDNA copy of one of the eight genomic segments of the influenza virus, from which viral RNA is transcribed and viral proteins are expressed. The transfection material was seeded into 6-well plates containing a Vero cell culture.

 

Fig. 1. Scheme of the technology for producing a recombinant influenza virus expressing mycobacterial proteins.

Рис. 1. Схема технологии получения рекомбинантного вируса гриппа, экспрессирующего микобактериальные белки.

 

One day after transfection, no pronounced cytopathic effect (CPE) of the virus was observed in Vero cells. The first signs of CPE development in Vero cell cultures for both strains were noted 36 hours after transfection. After 48 hours, the cell monolayer was completely destroyed (Fig. 2).

 

Fig. 2. Development of CPE of recombinant viral strains in Vero cell culture after transfection (Leitz Diavert 10×). a – recombinant strain A/Ast/PR8-NS124-TB10.4; b – recombinant strain A/Ast/PR8-NS124-ESAT6.

Рис. 2. Развитие ЦПД рекомбинантных вирусных штаммов на культуре клеток Vero после трансфекции (Leitz Diavert 10×). а – рекомбинантный штамм A/Ast/PR8-NS124-TB10.4; б – рекомбинантный штамм A/Ast/PR8-NS124-ESAT6.

 

The appearance of CPE in Vero cell culture after 36 hours indicates that infectious virus is formed within the first 2 days after transfection.

The effect of incubation temperature on the replication of the recombinant influenza viruses A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4 was studied during cultivation in Vero and MDCK cells at temperatures of 30, 35, and 37 °C (Table 1). The infectious titer of the viruses was determined 24, 48, and 72 hours after infection.

 

Table 1. Infectious titers of recombinant influenza viruses in Vero cells at different culture temperatures

Таблица 1. Инфекционный титр рекомбинантных вирусов гриппа в клетках Vero при различных температурах культивирования

Temperature, °C Температура, °C	Time, hour Время, ч
	24	48	72
A/Ast/PR8-NS124-ESAT6 (log10 TCE50/cm3) A/Ast/PR8-NS124-ESAT6 (lg ТЦД50/см3)
30	4.6 ± 0.3	6.1 ± 0.2	5.8 ± 0.2
35	5.2 ± 0.2	7.0 ± 0.2	6.5 ± 0.2
37	5.5 ± 0.2	7.2 ± 0.2	6.8 ± 0.2
A/Ast/PR8-NS124-TB10.4 (log10 TCE50/cm3) A/Ast/PR8-NS124-TB10.4 (lg ТЦД50/см3)
30	4.4 ± 0.3	6.0 ± 0.2	5.6 ± 0.2
35	5.0 ± 0.2	6.8 ± 0.2	6.3 ± 0.2
37	5.3 ± 0.2	7.1 ± 0.2	6.6 ± 0.2

 

It was found that temperature significantly affected the replication levels of both recombinant strains. Maximum infectious titers were observed at 37 ± 0.5 °C, whereas a decrease in viral biological activity was noted at 30–35 °C.

A comparative analysis of the replication of recombinant influenza viruses in MDCK and Vero cells showed that both cell lines supported effective viral replication; however, higher infectious titers were obtained in Vero cell culture.

The hemagglutination activity of the recombinant strains A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4 was determined by the HAI method using a 1% suspension of rooster erythrocytes. It was found that the level of hemagglutination activity correlated with the infectious titer (Table 2).

 

Table 2. Hemagglutinating activity of recombinant influenza viruses

Таблица 2. Гемагглютинирующая активность рекомбинантных вирусов гриппа

Virus strain Штамм вируса	Temperature, °C Температура, °C	HAR titer Титр РГА
FLU NS_ESAT6	30	1 : 32
	35	1 : 64
	37	1 : 128
FLU NS_TB10.4	30	1 : 32
	35	1 : 64
	37	1 : 128

 

The genetic stability of the mycobacterial insert in the NS gene was assessed by RT-PCR (Fig. 3) after each passage in developing chicken embryos. The NS gene of the passages under study was compared with the NS gene. The RT-PCR results confirmed that the length of the NS gene segment containing the mycobacterial protein insert was increased, measuring 1,170 base pairs for sample A/Ast/PR8-NS124-TB10.4 and 1,175 base pairs for sample A/Ast/PR8-NS124-ESAT6 (Fig. 3).

 

Fig. 3. Electropherogram of the NS gene segment. a – A/Ast/PR8-NS124-TB10.4 samples (lanes 1–2); b – A/Ast/PR8-NS124-ESAT6 samples (lanes 1–3); M – molecular weight marker; K− – negative control (deionized water); K+ – positive control (wild-type NS).

Рис. 3. Электрофореграмма сегмента гена NS. а – образцы A/Ast/PR8-NS124-TB10.4 (дорожки 1–2); б – образцы A/Ast/PR8-NS124-ESAT6 (дорожки 1–3); М – маркер молекулярного веса; К− – отрицательный контроль (деонизированная вода); К+ – положительный контроль (дикий NS).

 

Thus, it has been established that the NS gene segment contains an insertion of the mycobacterial proteins A/Ast/PR8-NS124-TB10.4 and A/Ast/PR8-NS124-ESAT6, which is maintained throughout the five passages studied.

Discussion

In this study, we optimized the culture conditions for recombinant influenza viruses expressing the immunodominant proteins M. bovis A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4. The results indicate that culture parameters have a significant effect on both viral replication and the stability of genetic inserts. It was found that temperature is one of the key factors determining the biological activity of the recombinant strains. The maximum infectious titers of both viruses were obtained when cultured at 37 °C, whereas raising the temperature to 35 ± 0.5 °C led to a decrease in the level of viral replication. This effect is likely due to the increased sensitivity of recombinant viruses carrying additional genetic inserts to intracellular proteolysis and stress induced by higher cultivation temperatures. A comparative analysis of cultivation in MDCK and Vero cell lines showed an advantage for Vero cells, which yielded a higher infectious titer of the recombinant viruses. This is consistent with data in the literature [7, 14] indicating the high sensitivity of Vero cells to influenza viruses and their widespread use for the production of viral material. Although MDCK cells supported viral replication, they exhibited slightly lower levels of biological activity.

The hemagglutination activity of the recombinant strains correlated with the infectious titer, indicating that the functional activity of viral hemagglutinin was preserved during cultivation. The highest HAI values were observed under optimal temperature conditions of 37 ± 0.5 °C, which further confirms the appropriateness of using this temperature regime.

Confirmation of the presence and stability of genetic inserts using RT-PCR showed that the NS segment of the recombinant viruses retained an enlarged size, corresponding to the inserted genes A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4, throughout the entire cultivation period. This indicates the genetic stability of the recombinant constructs and the absence of deletions in the inserts under optimized cultivation conditions.

Conclusion

As a result of the studies conducted, the culture conditions for the recombinant influenza viruses A/Ast/PR8-NS124-ESAT6 and A/Ast/PR8-NS124-TB10.4, which express immunodominant proteins from M. bovis, were optimized.

Vero cells were cultured in serum-free DMEM medium at 37 ± 0.5 °C and 5% CO₂, which allowed for the efficient accumulation of active viral biomass. The stability of the integrated genetic constructs was confirmed by RT-PCR. The results obtained indicate the potential for using recombinant influenza viruses as a vector system for delivering mycobacterial antigens.

The optimized culture parameters can be used in further studies aimed at the preclinical evaluation of the immunogenicity and protective efficacy of the developed recombinant influenza viruses, as well as in scaling up the process of viral material production.

About the authors

Ruslan T. Abitayev

Research Institute for Biological Safety Problems National Holding «QazBioPharm»; National Academy of Sciences of the Kyrgyz Republic

Author for correspondence.
Email: r.abitaev@biosafety.kz
ORCID iD: 0000-0001-5609-2491

M.Sc., PhD Student, Senior Researcher, Laboratory of Microorganism Cultivation Technology

Kazakhstan, 080409, Gvardeisky; 720071, Bishkek, Kyrgyzstan

Aisha U. Issabek

Research Institute for Biological Safety Problems National Holding «QazBioPharm»

Email: a.issabek@biosafety.kz
ORCID iD: 0000-0002-5623-7571

M.Sc., Senior Researcher, Laboratory of Molecular Biology and Genetic Engineering

Kazakhstan, 080409, Gvardeisky

Ainur S. Nurpeisova

Kazakh Research Veterinary Institute, National Holding «QazBioPharm»

Email: ainurnurpeisova@mail.ru
ORCID iD: 0000-0002-7039-5621

Ph.D., Deputy General Director for Production Development and Commercialization of Scientific Developments

Kazakhstan, 050016, Almaty

Yerbol A. Bulatov

Research Institute for Biological Safety Problems National Holding «QazBioPharm»

Email: ye.bulatov@biosafety.kz
ORCID iD: 0000-0001-8543-4219

Candidate of Biological Sciences, Professor, Head of the Laboratory of Microorganism Cultivation Technology

Kazakhstan, 080409, Gvardeisky

Bermet M. Khudaibergenova

National Academy of Sciences of the Kyrgyz Republic

Email: khudaibergenbermet@qmail.com
ORCID iD: 0009-0009-2153-1365

Professor, Chief Scientific Secretary, Head of the Department of Natural Sciences, International Higher School of Medicine

Kyrgyzstan, 720071, Bishkek

References

Supplementary files