Rapid differentiation of genotype I and new recombinant variant of African swine fever virus (Asfarviridae: Asfivirus) using real-time PCR
- Authors: Chernyshev R.S.1, Morozova E.O.1, Sadchikova A.S.1, Moiseenko D.S.1, Igolkin A.S.1
-
Affiliations:
- Federal Centre for Animal Health (ARRIAH)
- Issue: Vol 71, No 2 (2026)
- Pages: 150-161
- Section: ORIGINAL RESEARCHES
- URL: https://virusjour.crie.ru/jour/article/view/16836
- DOI: https://doi.org/10.36233/0507-4088-361
- EDN: https://elibrary.ru/lfwfvd
- ID: 16836
Cite item
Abstract
Introduction. The identification of I/II genotype recombinant African swine fever virus (ASFV) in China (2021) and its subsequent introduction to Primorsky region of Russia (2023) is a new challenge in control against ASF. The potential recombinant virus circulation may negate efforts to develop vaccines against ASF, vaccines that are based on genotype II strains) do not provide protection against recombinant virus.
The aim of the study was to develop qPCR for differentiation of genotype I and new recombinant ASFV variant in clinical samples from infected domestic pigs and wild boars.
Materials and methods. Samples of viral culture suspensions and biological material from pigs, ASF- free and infected with the recombinant ASFV strain Primorsky 2023/DP-4560 or genotype II strains were used. Positive control sample and standard plasmid were obtained using complex molecular cloning techniques to construct circular and linearized forms of plasmid pJET1.2_IREC.
Results. Primers and a TaqMan probe (modified with LNA, locked linear nucleic acid) were designed to the fragment of MGF 110-1L gene (93 bp). The specificity of RT-PCR was enhanced by increasing the annealing temperature to 65°C. Developed method had precision (repeatability (CV = 0.7–1.3%) and reproducibility (CV = 2.76–5.69%), 100% diagnostic specificity, 96% clinical sensitivity, and high linear dynamic range (R2 = 99.62) and efficiency (E = 95%). The limit of detection was 7 copies/µL (95% CI: 4–10 copies/µL) or 70 copies/per reaction.
Conclusion. The monoplex RT-PCR has been developed to study the extent of circulation in Russia of atypical variants originating from East Asia.
Keywords
Full Text
Introduction
The African swine fever (ASF) epidemic has been one of the most serious challenges facing the swine industry in Eurasian countries for over 18 years (2007 – present) [1]. Strengthened biosecurity measures have reduced the number of ASF outbreaks on pig farms; however, the virus continues to circulate in wild fauna, expanding its range and infecting new populations of the European wild boar (Sus scrofa) [2]. The illegal use of live (attenuated) ASF vaccines, which possess reversible properties and have not undergone safety and efficacy evaluation in accordance with the requirements of the World Organisation for Animal Health, also poses a threat [3–5]. In the context of a prolonged epidemic, the primary tools for combating ASF are surveillance (diagnosis and monitoring of genetic variants) and control (rapid eradication of outbreaks and prevention of disease spread) [6–8].
The ASF pathogen is an enveloped double-stranded DNA virus belonging to the family Asfarviridae, genus Asfivirus. The genome consists of a sequence ranging from 170,000 to 190,000 nucleotide pairs (base pairs, bp), encoding more than 150 open reading frames [9].
Currently, ASFV isolates are classified into 23 genotypes based on the variable fragment of the B646L gene [10]. The current ASF epidemic is attributed to the introduction of genotype II virus from Africa into Georgia and its subsequent spread across Eurasia, Oceania, and the Caribbean [1, 2, 7, 11–13]. However, in 2021, the Ministry of Agriculture of the People's Republic of China (PRC) reported the detection of genotype I ASFV in Henan and Shandong provinces. The origin of genotype I in China is linked to the illegal use of "vaccines" derived from attenuated non-hemadsorbing strains, as the isolates collected from the outbreaks exhibited low virulence and were phylogenetically grouped with the NH/P68 and OURT88/3 strains, which were isolated in Portugal [14].
The co-circulation of ASFV genotypes I and II in China resulted in the emergence of a recombinant variant of genotypes I/II. Thus, whole-genome analysis of three isolates (ASFV/Pig/Jiangsu/LG/2021, ASFV/Pig/Henan/123014/2022, and ASFV/Pig/Inner Mongolia/DQDM/2022), isolated in 2021–2022 from pigs in the provinces of Jiangsu, Henan, and Inner Mongolia, revealed their mosaic structure, recombination between ASFV genotypes I and II, as well as a significant percentage of identity among them [15]. In 2023, this same recombinant variant (referred to in the literature as the new recombinant) was first detected in the Primorsky Region of the Russian Federation and in three northern provinces of Vietnam (Fig. 1) [16–18].
Fig. 1. Distribution of the recombinant variant of ASFV in genotypes I/II in China, Russia, and Vietnam (2021–2023). The graphic design of the map was performed using the MapChart online platform.
Рис. 1. Распространение вируса АЧС рекомбинантного варианта I/II генотипов на территории Китая, России и Вьетнама (2021–2023 гг.). Графическое оформление карты выполнено на онлайн-платформе MapChart.
The new recombinant variant of the ASFV belongs to genotype I by the B646L gene; it is hemadsorbing and highly virulent, causing 100% mortality in domestic pigs [15–18]. It is known that an experimental vaccine proposed by researchers from the PRC based on the HLJ/18-7GD strain, which induces 100% protection against all circulating ASFV variants of genotypes II and I in China, is ineffective in challenge experiments with the recombinant strain [15, 19]. Furthermore, this strain infects pigs immunized with vaccines registered in Vietnam (AVAC ASF Live –ASFV-G-ΔMGF strain; NAVET-ASFVAC – ASFV-G-ΔI177L strain) [20]. Given the above factors, the potential widespread circulation of a new recombinant variant of the ASFV in Eurasia poses both an additional threat to the existing pig farming and wild boar hunting industries and a new challenge in the development of ASF vaccines.
The graphic design of the map was performed using the MapChart online platform.
Thus, molecular and epidemiological monitoring of ASF within the Russian Federation and other affected countries is essential for implementing early response measures and preventing the spread of new variants of the virus.
The aim of the study is to develop and validate a real-time polymerase chain reaction (qPCR) method for the rapid differentiation of genotype I and the recombinant variant of the ASFV.
Materials and methods
Viruses. The study utilized biological samples from pigs infected with the recombinant ASFV Primorsky 2023/DP-4560.Rec strain (blood, oronasal and rectal swabs, spleen, lymph nodes, lungs, liver, kidneys, muscle tissue, synovial fluid from joints, bone marrow) obtained as part of an animal experiment at the Federal Centre for Animal Health (ARRIAH) (Vladimir, Russia). Biological samples from domestic pigs and wild boars infected with ASFV genotype II or free of ASF were sent to the Reference Laboratory for ASF (ARRIAH) as part of state epidemiological monitoring. During the development and validation of the method, lyophilized material from 55 strains/isolates of ASFV genotypes I, II, and V and a new recombinant variant, 5 strains of classical swine fever (CSF), porcine reproductive and respiratory syndrome (PRRS), and Aujeszky's disease viruses, as well as a field isolate of the pathogen of swine erysipelas, which were obtained from the state collection of microorganism strains at the Federal Centre for Animal Health (ARRIAH).
The TaqMan primers and probe were designed using the NCBI Primer Design Tool based on the genomic sequences of ASFV strains and isolates of genotypes I and II, as well as a new recombinant variant.
DNA extraction was performed by affinity sorption using the RIBO-Sorb reagent kit (Central Research Institute of Epidemiology, Rospotrebnadzor, Russia) according to the manufacturer's instructions.
The initial status of the samples was determined using the PCR-ASF-ARRIAH diagnostic test system for the detection of a conserved fragment of the ASF virus genome (Federal Centre for Animal Health (ARRIAH), Russia) in accordance with the instructions for use.
The composition of the PCR mixture was optimized using a PCR reagent kit manufactured by Eurogen CJSC (Russia): 10X Taq Turbo buffer, HS Taq DNA polymerase, a mixture of deoxynucleotide triphosphates (dNTPs, 10 mM each), MgCl2 solution (50 mM), and nuclease-free water.
Real-time PCR was performed in a programmable amplifier with a real-time fluorescent signal detection system featuring 6 independent detection channels, the Rotor-Gene Q (Qiagen, Germany).
Comprehensive molecular cloning methods were used to develop a positive control sample (PCS) and quantitative standards (calibrators). Amplification of the target PCR fragment was performed on genomic DNA from the ASFV Primorsky 2023/DP-4560.Rec strain using the Platinum SuperFi II DNA Polymerase high-precision DNA polymerase reagent kit (Invitrogen, Lithuania). Detection of the results was performed by horizontal electrophoresis in a 1% agarose gel containing 0.001% ethidium bromide. Purification and concentration of the PCR product from the gel were performed using the Cleanup St Gel kit (Eurogen, Russia). Integration of the target fragment into the pJET1.2.blunt vector was performed via blunt ends according to the CloneJET PCR Cloning Kit manual (Thermo Fisher Scientific, USA). Transformation of Escherichia coli cells (strain XL1-BLUE, Eurogen) was performed using the heat-shock method. After screening, selection, and accumulation of clones, the pJET1.2_IREC plasmid was extracted from the bacterial culture suspension using the Plasmid Miniprep 2.0 kit (Eurogen). The resulting plasmid was linearized using Pst I restriction enzyme (FastDigest, Thermo Fisher, USA). After purification and concentration of the linearized plasmid, the number of copies was calculated based on the concentration (in ng/μL) measured by fluorimetry using the QuDye dsDNA HS kit for quantifying double-stranded DNA on the Fluo-200 (Hangzhou Allsheng Instruments, China). We then prepared 10-fold dilutions of the plasmid and used them as standards in the quantitative real-time PCR assay.
To validate the developed method, we followed the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines [21, 22]. We determined precision in terms of repeatability and reproducibility, analytical specificity, diagnostic sensitivity and specificity, linearity, efficiency, and analytical sensitivity (limit of detection).
Statistical data analysis was performed using Microsoft Excel (Microsoft Office Professional Edition, 2003); the level of statistical significance (p) was calculated using the Mann–Whitney U-test. Graphs were generated using GraphPad Prism.
Results
Oligonucleotide design. Analysis of the alignment of full-length genome sequences from ASFV strains of genotypes I and II, as well as a new recombinant variant, identified the most heterologous region (the MGF 110-1L gene fragment), containing 17 single-nucleotide polymorphisms (substitutions) in genotype I strains and the recombinant variant compared to genotype II strains (Fig. 2). Performed in SnapGene v. 5.2.1.
Fig. 2. Alignment of the MGF 110-1L gene fragment nucleotide sequences of ASFV genotypes I, II and recombinant variant strains. Performed in SnapGene v. 5.2.1.
Рис. 2. Выравнивание нуклеотидных последовательностей фрагмента гена MGF 110-1L штаммов вируса АЧС I, II генотипов и рекомбинантного варианта. Выполнено в программе SnapGene v. 5.2.1.
Based on the data presented in Fig. 2, the MGF 110-1L gene fragment is identical in ASFV genotype I and the recombinant variant, and is also optimal for the specific annealing of primers and the TaqMan probe for the purpose of differentiating genotype II virus. Subsequently, a system of oligonucleotides containing LNA (Locked Nucleic Acid) modifications was developed (Table).
Table. Primers and TaqMan probe for specific annealing to DNA of genotype I and recombinant variants ASFV
Таблица. Последовательность праймеров и TaqMan-зонда для специфичного отжига на матрице ДНК вируса АЧС I генотипа и рекомбинантного варианта
Gene Ген | Name of oligonucleotide Название олигонуклеотида | Sequence 5'-3' Последовательность | Fragment size (bp) Размер фрагмента (п.н.) |
MGF 110-1L | ASFV 1subF | GAAGACCAGCAAATACATAAC | 97 |
ASFV 1subR | ATTGTTAACCTATGGATTTTATCTTGC | ||
ASFV 1subProbe | Cy5 TGCGAATGTAATTCACAGC BHQ2 |
Примечание. Нуклеотиды, выделенные крупным и жирным шрифтом, несут модификацию LNA.
Note. The nucleotides highlighted in large and bold letters contain LNA modifications.
As shown in the table, the TaqMan probe is labeled with the Cy5 fluorophore (cyanine-5, red channel), the BHQ2 quencher (black hole quencher 2 with a fluorescence quenching range of 550–650 nm), and contains 5 LNA modifications to increase the annealing temperature (Ta).
Optimization of qPCR conditions. Since the method under development is a differential diagnostic technique, and the study subjects are samples with known status (samples from ASF-positive domestic pigs and wild boars, as well as a virus-containing cell culture suspension), the temperature-time profile of the reaction was determined based on the principle of operational efficiency. The initial qPCR program included a general DNA denaturation step (95 °C, 5 min) and 35 amplification cycles: denaturation (95 °C, 10 s), primer annealing, and elongation (60 °C, 25 s, with signal detection on the red channel), and the PCR mixture per reaction contained: 1× Taq Turbo buffer, 2 mM MgCl2, 0.2 mM of each dNTP, 0.4 μM of ASFV 1subF primer, 0.4 μM of ASFV 1subR primer, 0.2 μM of ASFV 1subProbe probe, 3 units HS Taq DNA polymerase, 10.0 μL of DNA template, and nuclease-free water to a final reaction volume of 25.0 μL.
In further studies, the components of the PCR mixture were optimized (MgCl2 concentration (1–4 mM) and HS Taq DNA polymerase (1–5 units)) using genomic DNA from the ASFV Primorsky 2023/DP-4560.Rec strain as a template. The results are presented in Fig. 3.
Fig. 3. Optimization of MgCl2 and Taq DNA polymerase content in the PCR mixture. Ct is the threshold amplification cycle.
Рис. 3. Оптимизация содержания MgCl2 и HS Taq ДНК-полимеразы в составе ПЦР-смеси. Ct – пороговый цикл амплификации.
Based on the data in the graph (Fig. 3), the optimal concentration of MgCl2 in the PCR mixture is 4 mM, as this concentration results in earlier detection of the target fragment, and 2 units of HS Taq DNA polymerase, as increasing this concentration does not result in statistically significant differences (p > 0.05).
We also optimized the Ta of the primers in the range of 55–65 °C using genomic DNA from the ASFV Primorsky 2023/DP-4560.Rec strain (Fig. 4).
As shown in Fig. 4, increasing the Ta from 55 to 65 °C does not affect the efficiency of qPCR (p > 0.05). To increase specificity, in the final version of the reaction profile, the temperature of the primer annealing and elongation stages was set at 65 °C.
Fig. 4. Determination of the highest primer annealing temperature (Ta) in qPCR, which does not affect the detection efficiency. Ct is the threshold amplification cycle.
Рис. 4. Определение наибольшей Ta праймеров в ПЦР-РВ, не влияющей на эффективность реакции. Ct – пороговый цикл амплификации.
Obtaining control samples. The extracted genomic DNA of the Arm 07 strain or any other reference strain of the ASFV II genotype was selected as a negative control.
The pJET1.2_IREC recombinant plasmid, containing the target fragment of the MGF 110-1L gene from the ASFV Primorsky 2023/DP-4560.Rec strain, was constructed as a positive control (Fig. 5).
Fig. 5. A genetic map of plasmid pJET1.2_IREC, encoding a fragment of MGF 110-1L gene from the strain "ASFV Primorsky 2023/DP-4560 Rec". Visualization of the sequence was performed using the SnapGene v. 5.2.1.
Рис. 5. Генетическая карта плазмиды pJET1.2_IREC, кодирующей фрагмент гена MGF 110-1L штамма «ASFV Primorsky 2023/DP-4560.Rec». Визуализация последовательности выполнена в программе SnapGene v. 5.2.1.
Interpretation of qPCR results. The results were interpreted based on whether the S-shaped fluorescence curve crossed the threshold line (0.05) set at the appropriate level, which determines the Ct value (Fig. 6). Outlier removal was set to no more than 10%.
Fig. 6. The accumulation curve of the fluorescent signal in the «red» channel (detection of the target fragment of the MGF 110-1L gene).
Рис. 6. Кривая накопления флуоресцентного сигнала на канале red (детекция целевого фрагмента гена MGF 110-1L).
The result was considered valid if correct results were obtained for the positive and negative controls. A sample was considered positive for the presence of the ASFV genotype I genome or a recombinant variant if the Ct value on the red channel was ≤ 35. A negative result for the presence of the ASFV genotype I genome or a recombinant variant was interpreted if the Ct value on the "red" channel was absent.
Method validation. To assess agreement, one researcher tested 10 different standards in three parallel experiments; to assess reproducibility, two researchers tested 10 standards in three parallel experiments over three consecutive days. The results were expressed as a coefficient of variation (CV) for the obtained copy numbers. Thus, the CV for determining agreement was 0.7–1.3% (reference ≤ 5%), and for determining reproducibility, it was 2.76–5.69% (reference ≤ 10%).
To assess the method's suitability for laboratory practice and determine its analytical specificity, virulent and vaccine strains of viruses and bacteria causing the most common infectious diseases in pigs were selected. Studies have shown that the developed method specifically detects only the genome of the ASFV genotype I or its recombinant variants (strains ASFV Primorsky 2023/DP-4560.Rec, ASFV Primorsky 2023/DP-4618.Rec, Congo-49 (K-49), Lisbon-57 (L-57), and does not produce false-positive qPCR results when testing: the ASFV genotype V strain (Mozambique-78 (M-78), 50 genotype II strains and isolates (Arm 07, ASFV Kaliningrad_18 WB-12516, Odintsovo 02/14, ASFV/CV60/2020, ASFV/Karamzino 06/13, ASFV/Lipetsk 12/16, 44 isolates isolated in the Far East (2019–2021), the virulent Xi-min strain and the SK vaccine strain of the CSFV, the reference strains Lelystad of the European-type PRRSVand Irkutsk 2007/1 of the American-type PRRSV, the VK-DEP vaccine strain of the Aujeszky's disease virus, and a field isolate of Erysipelothrix rhusiopathiae (swine erysipelas bacteria).
When testing 213 known-negative samples of biological material from domestic pigs infected with ASFV genotype II or free of ASF, no false-positive results were recorded. Thus, the diagnostic specificity was 100%.
To determine diagnostic sensitivity, 24 known positive samples were tested from pigs No. 30, 35, and 37, which had been experimentally infected with the recombinant ASFV Primorsky 2023/DP-4560.Rec strain. The results are presented in Fig. 7.
Fig. 7. Investigation of positive samples containing the ASFV of new recombinant variant (n = 3).
Рис. 7. Исследование заведомо положительных образцов, содержащих вирус АЧС нового рекомбинантного варианта (n = 3).
As shown in Fig. 7, only one mesenteric lymph node sample from a pig infected with recombinant strain No. 37 showed a negative result in the qPCR assay. Thus, the diagnostic sensitivity of the method was 96%.
To calculate the analytical sensitivity, 20 tests were performed using calibrators (10-fold dilutions of linearized pJET1.2_IREC with a known initial copy number). The limit of detection was 7 copies/μL (95% CI: 4–10 copies/μL) or 70 copies per reaction.
The linearity and efficiency of the reaction were determined in a single test of 10 standards (Fig. 8).
Fig. 8. Graph of the inverse linear dependence of Ct values on the number of copies of the linearized plasmid pJET1.2_IREC (n = 3).
Рис. 8. График обратной линейной зависимости показателей Ct от числа копий линеаризованной плазмиды pJET1.2_IREC (n = 3).
Based on the data in the graph (Fig. 8), the method exhibits linearity (coefficient of determination R2 ≥ 99) and high efficiency (E = 95%).
Discussion
The circulation of various genetic variants of the ASFV in the People's Republic of China poses a potential threat to the Russian Federation [23]. Given the high risk of the introduction of the low-virulence ASFV of genotype I and the spread of a highly virulent new recombinant variant, methods are needed that enable early differentiation. qPCR is a well-established method of laboratory diagnosis that surpasses the loop-mediated isothermal amplification (LAMP) rapid test in terms of specificity and sensitivity, and retrospective methods (PCR with electrophoretic detection, phylogenetic analysis) in terms of the shortest reaction time [24]. Due to the method's reliability, the use of qPCR is of paramount importance in both routine and reference ASF diagnosis.
Multiplex qPCR methods for differentiating ASFVgenotypes I and II began to be rapidly developed in China starting in 2022. Thus, Q. Gao et al. (2022) proposed a duplex qPCR with hybridization-fluorescence detection for the amplification of the B646L gene fragment of genotype I and the E183L gene fragment of genotype II. Unfortunately, under current conditions, the detection limit was low (1.07 × 10² copies/μL for the B646L locus and 3.13 × 104 copies/μL for the E183L locus) [25]. Subsequently, X. Li et al. (2022) developed a duplex qPCR using two pairs of primers and two probes targeting a single gene—E296R. The analytical sensitivity of the method was higher, at 10 copies/μL for both genotype I and genotype II [26]. S. Cao et al. (2022) used a single pair of primers targeting the B646L gene fragment and two MGB-modified TaqMan probes labeled with the fluorophores FAM (genotype I) and VIC (genotype II). This universal approach proved effective and allowed for an increase in the qPCR detection limit, which was 10 copies/reaction (for genotype I) and 100 copies/reaction (for genotype II) [27]. It should be noted that these methods have not been optimized to detect the new recombinant variant, and their specificity with respect to it is unknown.
In 2022, R. Song et al. developed a rapid duplex Insulated Isothermal PCR (iiPCR), which has high analytical sensitivity (20 copies/reaction) and takes 40 minutes to perform [28]. Like any other rapid molecular method, iiPCR requires specific equipment and reagents. Given that most veterinary diagnosis laboratories are already equipped to perform qPCR, widespread use of iiPCR in the coming years seems unlikely.
Following the discovery of a new recombinant variant (2023), several research groups in China developed methods for its detection. For example, X. Qian et al. (2023) proposed a multiplex qPCR assay designed to detect fragments of the B646L (all genotypes), F1055L (genotype I), and E183L (genotype II) genes. The method demonstrated satisfactory specificity with respect to the recombinant (simultaneous fluorescent signal on all channels in the absence of inhibition), but low analytical sensitivity (355–400 copies/reaction) [29]. L. Ding et al. (2024) used a similar triplex qPCR method, but for the detection of the B646L, X64R, and MGF 360-14L gene fragments. The detection limit was higher, at 10 copies/reaction [30]. Subsequently, Z. Hu et al. (2024) developed a duplex qPCR assay to detect fragments of the MGF 110-1L (genotype I) and O61R (genotype II) genes. Despite high analytical sensitivity for each fragment individually (30 copies/reaction), the limit of detection for the simultaneous amplification of the two fragments was not determined, which calls into question the possibility of reliably detecting the recombinant variant of the ASF virus [31].
All of the methods listed above are designed for diagnosis and simultaneous differentiation. In our view, this approach is labor-intensive, costly, and excessive for the initial diagnosis. The differentiation of genetic variants of ASFV is not part of routine laboratory testing. PCR test systems available on both the local and international markets detect a conserved fragment of the ASFVgenome. Consequently, it is important to develop rapid, specific, and sensitive methods for differentiating atypical variants for use in reference laboratories, which process samples from animals with a confirmed diagnosis. Testing samples that do not contain the ASFV genome—which constitute the vast majority—during the monitoring of atypical variants is costly and impractical. The monoplex qPCR proposed in this study allows for the rapid (reaction time 54 min) detection of the ASFV genome of genotype I and a recombinant variant. It also allows for the reuse of the sample's DNA template (extracted nucleic acid) that was used in the initial diagnosis of ASF. In this case, a phased testing strategy reduces financial and labor costs. Of course, for the purpose of a thorough molecular and epidemiological characterization of the isolate, following the detection of atypical variants in the genome, a phylogenetic analysis based on marker regions, as previously proposed by us [32], should be conducted. However, since the majority of ASF cases in Russia are caused by the genotype II virus, the retrospective method will rarely be applied.
Conclusion
From 2021 to the present, there has been a risk of the introduction of the ASFV genotype I virus from China and the spread of a recombinant variant of genotypes I/II within the Russian Federation. To enable their rapid detection, a method has been developed that exhibits precision (CV ≤ 5%), reproducibility (CV ≤ 10%), 100% diagnostic specificity, 96% diagnostic sensitivity, linearity, 95% efficiency, and high analytical sensitivity (7 copies/µL, or 70 copies/reaction), indicating its suitability for use in the epizootic surveillance system for the spread of atypical variants of the ASFV.
About the authors
Roman S. Chernyshev
Federal Centre for Animal Health (ARRIAH)
Author for correspondence.
Email: chernishev_rs@arriah.ru
ORCID iD: 0000-0003-3604-7161
Cand. Sci. (Biol.), Research Assistant, Reference Laboratory for ASF
Russian Federation, VladimirElizaveta O. Morozova
Federal Centre for Animal Health (ARRIAH)
Email: morozova_eo@arriah.ru
ORCID iD: 0000-0002-0955-9586
postgraduated student, biologist, Reference Laboratory for ASF
Russian Federation, VladimirAnastasia S. Sadchikova
Federal Centre for Animal Health (ARRIAH)
Email: sadchikova@arriah.ru
ORCID iD: 0009-0001-0801-2394
postgraduated student, veterinarian, Reference Laboratory for ASF
Russian Federation, VladimirDanila S. Moiseenko
Federal Centre for Animal Health (ARRIAH)
Email: moiseenko_ds@arriah.ru
ORCID iD: 0009-0003-4465-0179
postgraduated student, veterinarian, Reference Laboratory for ASF
Russian Federation, VladimirAlexey S. Igolkin
Federal Centre for Animal Health (ARRIAH)
Email: igolkin_as@arriah.ru
ORCID iD: 0000-0002-5438-8026
Cand. Sci. (Vet.), Deputy Head of the Laboratory and Diagnosis Center – Head of Reference Laboratory for ASF
Russian Federation, VladimirReferences
- Beltrán-Alcrudo D., Lubroth J., Depner K., de La Rocque S. African swine fever in the Caucasus. EMPRES Watch. 2008; 1(8): 1–8. https://doi.org/10.13140/RG.2.1.3579.1200
- Sauter-Louis C., Conraths F.J., Probst C., Blohm U., Schulz K., Sehl J., et al. African swine fever in wild boar in Europe – a review. Viruses. 2021; 13(9): 1717. https://doi.org/10.3390/v13091717
- Chandana M.S., Nair S.S., Chaturvedi V.K., Abhishek, Pal S., Charan M.S.S., et al. Recent progress and major gaps in the vaccine development for African swine fever. Braz. J. Microbiol. 2024; 55(1): 997–1010. https://doi.org/10.1007/s42770-024-01264-7
- van den Born E., Olasz F., Mészáros I., Göltl E., Oláh B., Joshi J., et al. African swine fever virus vaccine strain Asfv-G-∆I177l reverts to virulence and negatively affects reproductive performance. NPJ Vaccines. 2025; 10(1): 46. https://doi.org/10.1038/s41541-025-01099-9
- Ambagala A., Goonewardene K., Kanoa I.E., Than T.T., Nguyen V.T., Lai T.N.H., et al. Characterization of an African swine fever virus field isolate from Vietnam with deletions in the left variable multigene family region. Viruses. 2024; 16(4): 571. https://doi.org/10.3390/v16040571
- Zhang Y., Wang Q., Zhu Z., Wang S., Tu S., Zhang Y., et al. Tracing the origin of genotype II African swine fever virus in China by genomic epidemiology analysis. Transbound. Emerg. Dis. 2023; 2023: 4820809. https://doi.org/10.1155/2023/4820809
- Dixon L.K., Stahl K., Jori F., Vial L., Pfeiffer D.U. African swine fever epidemiology and control. Annu. Rev. Anim. Biosci. 2020; 8: 221–46. https://doi.org/10.1146/annurev-animal-021419-083741
- Skorobagatko D.A., Tolkova E.S., Shepeleva O.A., Shapovalov S.O. African swine fever virus (Asfarviridae, Asfivirus) strains from the central regions of Russia, carrying variant 5 of the central variable region (CVR), are characterized by tandem duplication in the intergenic region MGF 360-13L – MGF 360-14L. Problems of Virology. 2026; 71(1): 42–52. https://doi.org/10.36233/0507-4088-357
- Blasco R., de la Vega I., Almazán F., Agüero M., Viñuela E. Genetic variation of African swine fever virus: variable regions near the ends of the viral DNA. Virology. 1989; 173(1): 251–7. https://doi.org/10.1016/0042-6822(89)90241-9
- Bastos A.D., Penrith M.L., Crucière C., Edrich J.L., Hutchings G., Roger F., et al. Genotyping field strains of African swine fever virus by partial p72 gene characterisation. Arch. Virol. 2003; 148(4): 693–706. https://doi.org/10.1007/s00705-002-0946-8
- Mighell E., Ward M.P. African Swine Fever spread across Asia, 2018–2019. Transbound. Emerg. Dis. 2021; 68(5): 2722–32. https://doi.org/10.1111/tbed.14039
- Ramirez-Medina E., O’Donnell V., Silva E., Espinoza N., Velazquez-Salinas L., Moran K., et al. Experimental infection of domestic pigs with an African swine fever virus field strain isolated in 2021 from the Dominican Republic. Viruses. 2022; 14(5): 1090. https://doi.org/10.3390/v14051090
- Shotin A.R., Chernyshev R.S., Morozova E.O., Igolkin A.S., Gruzdev K.N., Kolbin I.S., Lavrentiev I.A., Mazloum A. Molecular and biological properties of the African swine fever virus (Asfarviridae: Asfivirus) isolate ASF/Tatarstan 20/WB-12276. Problems of Virology. 2023; 68(4): 302–314. https://doi.org/10.36233/0507-4088-182
- Sun E., Huang L., Zhang X., Zhang J., Shen D., Zhang Z., et al. Genotype I African swine fever viruses emerged in domestic pigs in China and caused chronic infection. Emerg. Microbes Infect. 2021; 10(1): 2183–93. https://doi.org/10.1080/22221751.2021.1999779
- Zhao D., Sun E., Huang L., Ding L., Zhu Y., Zhang J., et al. Highly lethal genotype I and II recombinant African swine fever viruses detected in pigs. Nat. Commun. 2023; 14(1): 3096. https://doi.org/10.1038/s41467-023-38868-w
- Igolkin A.S., Chernyshev R.S., Zinyakov N.G., Morozova E.O., Shotin A.R., Gruzdev K.N., et al. First detection of recombinant variant of African swine fever virus in the Russian Federation (brief communication). Veterinariya segodnya. 2024; 13(3): 298–300. https://doi.org/10.29326/2304-196X-2024-13-3-298-300 https://elibrary.ru/qjijek (in Russian)
- Igolkin A., Mazloum A., Zinyakov N., Chernyshev R., von Schalkwyk A., Shotin A., et al. Detection of the first recombinant African swine fever virus (genotypes I and II) in domestic pigs in Russia. Mol. Biol. Rep. 2024; 51(1): 1011. https://doi.org/10.1007/s11033-024-09961-0
- Lee K., Vu T.T.H., Yeom M., Nguyen V.D., Than T.T., Nguyen V.T., et al. Molecular characterization of emerging recombinant African swine fever virus of genotype I and II in Vietnam, 2023. Emerg. Microbes Infect. 2024; 13(1): 2404156. https://doi.org/10.1080/22221751.2024.2404156
- Wang Z., Zhang J., Li F., Zhang Z., Chen W., Zhang X., et al. The attenuated African swine fever vaccine HLJ/18-7GD provides protection against emerging prevalent genotype II variants in China. Emerg. Microbes Infect. 2024; 13(1): 2300464. https://doi.org/10.1080/22221751.2023.2300464
- Diep N.V., Duc N.V., Ngoc N.T., Dang V.X., Tiep T.N., Nguyen V.D., et al. Genotype II live-attenuated ASFV vaccine strains unable to completely protect pigs against the emerging recombinant ASFV genotype I/II strain in Vietnam. Vaccines (Basel). 2024; 12(10): 1114. https://doi.org/10.3390/vaccines12101114
- Bustin S.A., Benes V., Garson J.A., Hellemans J., Huggett J., Kubista M., et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009; 55(4): 611–22. https://doi.org/10.1373/clinchem.2008.112797
- Doronin M.I., Mikhalishin D.V., Sprygin A.V., Mazloum A., Zhbanova T.V., Gruzdev K.N., et al. Current approaches to development of real-time qPCR test-kits. Veterinariya segodnya. 2023; 12(3): 197–207. https://doi.org/10.29326/2304-196X-2023-12-3-197-207 https://elibrary.ru/olsbro (in Russian)
- Ito S., Bosch J., Martínez-Avilés M., Sánchez-Vizcaíno J.M. The evolution of African swine fever in China: a global threat? Front. Vet. Sci. 2022; 9: 828498. https://doi.org/10.3389/fvets.2022.828498
- Sengar G.S., Chakravarti S., Deb R., Pegu S.R., Anjaria P., Sonowal J., et al. Comparative assessment of two in-house-built isothermal assays for visual detection of African swine fever virus. J. Biosci. 2024; 49: 69.
- Gao Q., Feng Y., Yang Y., Luo Y., Gong T., Wang H., et al. Establishment of a dual real-time PCR assay for the identification of African swine fever virus genotypes I and II in China. Front. Vet. Sci. 2022; 9: 882824. https://doi.org/10.3389/fvets.2022.882824
- Li X., Hu Y., Liu P., Zhu Z., Liu P., Chen C., et al. Development and application of a duplex real-time PCR assay for differentiation of genotypes I and II African swine fever viruses. Transbound. Emerg. Dis. 2022; 69(5): 2971–9. https://doi.org/10.1111/tbed.14459
- Cao S., Lu H., Wu Z., Zhu S. A duplex fluorescent quantitative PCR assay to distinguish the genotype I and II strains of African swine fever virus in Chinese epidemic strains. Front. Vet. Sci. 2022; 9: 998874. https://doi.org/10.3389/fvets.2022.998874
- Song R., Liu P., Yang Y., Lee H.S., Chen C., Wu X., et al. Development of a duplex insulated isothermal PCR assay for rapid on-site detection and differentiation of genotypes 1 and 2 of African swine fever virus. Front. Cell. Infect. Microbiol. 2022; 12: 948771. https://doi.org/10.3389/fcimb.2022.948771
- Qian X., Hu L., Shi K., Wei H., Shi Y., Hu X., et al. Development of a triplex real-time quantitative PCR for detection and differentiation of genotypes I and II African swine fever virus. Front. Vet. Sci. 2023; 10: 1278714. https://doi.org/10.3389/fvets.2023.1278714
- Ding L., Ren T., Bing G., Wang Z., Wang B., Ni J., et al. Establishment of a Triplex qPCR assay for differentiating highly virulent genotype I recombinant virus from low-virulence genotype I and genotype II African swine fever viruses circulating in China. Transbound. Emerg. Dis. 2024; 2024: 6206857. https://doi.org/10.1155/2024/6206857
- Hu Z., Lai R., Tian X., Guan R., Li X. A duplex fluorescent quantitative PCR assay to distinguish the genotype I, II and I/II recombinant strains of African swine fever virus in China. Front. Vet. Sci. 2024; 11: 1422757. https://doi.org/10.3389/fvets.2024.1422757
- Chernyshev R., Morozova E., Zinyakov N., Mazloum A., Lavrentiev I., Shotin A., et al. Genetic variations of African swine fever virus MGF 505-9R/10R and I73R/I329L intergenic regions: their role in differentiation between recombinant variant and genotype I and II isolates. Arch. Virol. 2025; 170(11): 220. https://doi.org/10.1007/s00705-025-06431-1
Supplementary files











