Differentiation of vaccine strains and field isolates of bovine herpesvirus type 1 (Orthoherpesviridae: Varicellovirus)

Cover Page


Cite item

Abstract

Introduction. Differentiation of vaccine strains and field isolates of bovine type 1 herpesvirus Varicellovirus bovinealpha1 is an urgent task to improve the quality of diagnosis of infectious bovine rhinotracheitis (IBR). There are several approaches to solve this problem. The most successful methods are those proposed by R.W. Fulton and S.K. Chothe in 2013 and 2018, respectively.

The aim of the study is to test the methods proposed by R.W. Fulton and S.K. Chothe to study the possibility of their optimization and implementation in routine laboratory diagnostics of IBR in Russia.

Materials and methods. 4 vaccine strains and 6 field isolates of the IBR virus were studied using PCR-based algorithms by R.W. Fulton and S.K. Chothe to determine the presence of single nucleotide substitutions at 11 control points of the virus genome in comparison with the nucleotide sequence of the reference strain Cooper JX898220.

Results. Both methods confirmed that the domestic strains of the IBR virus used for the production of inactivated vaccines originate from field isolates of the virus. Both the reference and modern epizootic isolates obtained by us and our colleagues at different times in Russia are epizootic strains that have no direct connection with the large-scale use of foreign vaccines, including live ones, both among our own indigenous livestock and among animals imported from abroad. None of the methods we tested allows us to distinguish between Varicellovirus bovinealpha1 and Varicellovirus bovinealpha5.

Conclusion. The methods proposed by R.W. Fulton (2013) and S.K. Chothe (2018) can be used to differentiate vaccine strains and field isolates of IBR virus only after our recommended preliminary differentiation of BoHV of types 1 and 5.

Full Text

Introduction

Bovine herpesvirus type 1 (BoHV-1), Varicellovirus bovinealpha1 (VB1), the pathogen of infectious bovine rhinotracheitis (IBR), belongs to the Varicellavirus genus, Alphaherpesvirinae subfamily. The genetic apparatus of this virus is represented by a linear double-stranded DNA 135–137 thousand nucleotide pairs long. The virus genome consists of two segments (L- – 103 thousand nucleotide pairs and S- – 34 thousand nucleotide pairs) that are covalently linked to each other [1]. These segments (UL and US) are rich in repetitive regions. The US segment is oriented differently relative to the UL segment in different strains, which is why two isoforms of the virus have been identified. Most of the DNA regions encoding the sequence of the main viral proteins are fairly conservative, with variable regions mainly located at the ends of the UL and US segments [2].

A unique feature of BoHV-1 is its ability to remain latent in susceptible animals. It is believed that latency occurs in almost all animals infected with high doses of a weakened strain or low doses of a virulent strain of the virus, so vaccination with high doses of an attenuated strain can lead to viral latency in the animal’s body, and such vaccination will not provide protection against the pathogen. It is also important to note that vaccination of animals in the latent form of infection does not prevent the release of field virus from the animal’s body [3–6].

Specific prevention measures form the basis of efforts to control the spread and containment of IBR. Particular attention should be paid to the use of live vaccines, since the attenuated virus can persist for a long time in the body of vaccinated animals and, when released into the environment under stress, can be transmitted to other animals. This feature of the pathogen can lead to false positive results in laboratory diagnosis of this disease [6].

Thus, the development of methods to differentiate between field isolates and BoHV-1 vaccine strains is undoubtedly a highly relevant task for veterinary medicine.

To date, there is no effective method that can be easily used in routine laboratory diagnostics to solve this problem.

The differentiation of vaccine strains and field isolates of BoHV-1 can be carried out based on data on the structure of their complete genomes. However, whole-genome sequencing of herpesviruses is still very costly and cannot be widely used in laboratory diagnosis of IBR.

In 2013, a team of American researchers led by R.W. Fulton, based on the results of whole-genome sequencing of 8 vaccine strains and 14 field isolates of the IBR virus, proposed a method for dividing all known strains of the IBR virus into 4 groups based on the identification of single nucleotide substitutions in the genome sequences of these viruses [7].

In subsequent studies, the same group of authors continued to characterize additional single nucleotide polymorphisms (SNPs) that, for various reasons, were not included in the initial study. The results of the polymerase chain reaction (PCR) did not allow field strains of Bovine alphaherpesvirus 1 (BoHV-1) to be distinguished from vaccine strains, but based on sequencing and further analysis, field and vaccine strains were differentially identified. As a result, the authors concluded that the developed method can be used to differentiate BoHV-1 vaccine strains from field strains in cases of reproductive dysfunction [8–11].

In our opinion, the best results in this regard were obtained by S.K. Chothe et al. (2018). This group of authors proposed an algorithm for differentiating vaccine strains and field isolates of the IBR virus based on the identification of single nucleotide substitutions in one of three positions of the virus genome, which is theoretically simpler than the methods presented in a study by R.W. Fulton et al. (2013) [12].

However, both of these methods can be used to differentiate vaccine strains and field isolates of the virus in question only if live vaccines produced from foreign vaccine strains were used for specific prevention of IBR on the farms in question. Local live vaccines intended for the specific prevention of IBR are produced from the attenuated strain TK/A, which is a type 5 bovine herpesvirus (Varicellovirus bovinealpha5) and, accordingly, has a genome structure that is only 86% complementary to the BoHV-1 genome structure [13].

In the Russian Federation, only one study has been conducted on the differentiation of the TK/A vaccine strain, which is known to be a representative of BoHV-1, from epizootic strains and isolates of the IBR cattle pathogen using RFLP analysis (restriction fragment length polymorphism)1. At the same time, as of September 1, 2025, 18 names of biological products have been officially registered for the specific prevention of IBR. Of these, two are monovalent vaccines manufactured abroad, which contain a live attenuated IBR virus. The remaining 16 biological products are associated vaccines manufactured locally and abroad with both live and inactivated components. Live vaccines against IBR sold in the Russian Federation contain attenuated strains of the IBR virus: TK-A (VIEV) B-2, GK/D, C-13, RLB 106, CEDDEL. Inactivated vaccines contain the following strains in their antigenic composition: TK-A (VIEV) B-2, T, ARRIAH and LA2.

The aim of the study is to test the methods proposed by R.W. Fulton and S.K. Chothe to explore the possibility of their optimization and implementation in routine laboratory diagnostics of IBR in the Russian Federation.

Materials and methods.

Cell culture. A passable calf kidney cell culture (MDBK) was used for virus reproduction.

Virus. The following strains and isolates of the IBR virus were studied:

  1. TK/A – a local attenuated vaccine strain acquired from the collection of the Russian State Center for Animal Feed and Drug Standardization and Quality (it is a type 5 herpesvirus of cattle) [13].
  2. T – a l vaccine strain obtained from the collection of the Shchelkovsky Biokombinat Federal State Unitary Enterprise.
  3. GK/D – a vaccine strain isolated by us from a commercial batch of Bovilis IBR Marker live vaccine, Unisolve (Intervet International B.V., Netherlands).
  4. 4016 – reference field isolate from the collection of the Department of Virology and Microbiology named after Academician V.N. Syurin, Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin.
  5. Monorin – reference field isolate from the collection of the Department of Virology and Microbiology named after Academician V.N. Syurin Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin.
  6. V-49 – field isolate isolated at a livestock farm in Shatursky, Moscow Region.
  7. MBA – a reference field isolate from the collection of the Department of Virology and Microbiology named after Academician V.N. Syurin, Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin.
  8. Kuibyshev-2006 – a field isolate obtained at a livestock farm in the Samara Region in 2006.
  9. Zelenogradsky – a field isolate isolated at a livestock farm in Pushkino, Moscow Region (it is a type 5 bovine herpesvirus, unpublished data).
  10. Orenburg 1/70 – a reference strain from the collection of the Department of Virology and Microbiology named after Academician V.N. Syurin, Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin.

Cell cultivation. Cell cultivation was carried out in polystyrene culture flasks with a growth area of 75 cm² and a non-ventilated lid under thermostat conditions at 37 °C. Igl DMEM medium (PanEco, Russia) with 7% bovine serum (HyClone, USA) was used as the growth medium. Cultures were subcultured once a week at a ratio of 1:4.

Virus infection of cultures. Cell culture infection was performed after the formation of a complete monolayer on the 1st–2nd day after cell seeding. The growth medium was drained. The cell monolayer was washed twice with Igla DMEM medium. After that, virus-containing material was added to the flask at a rate of 1.0 TCID50/cell and placed in a thermostat at 37 °C for 1 hour. Then, the contents of the culture flask were drained and a maintenance medium (Igl DMEM without serum) was added without prior washing of the monolayer. After that, the flask was placed in a separate thermostat at 37 °C. The cytopathic effect of the viruses was assessed daily visually under low magnification of an inverted microscope until most of the monolayer detached from the substrate. The virus-containing suspension was used in further studies. The infectious titer of the virus was determined using the Reed and Mench method.

Polymerase chain reaction. Total DNA was extracted from 100 μL of each sample using the MAGNO-Sorb RNA/DNA extraction kit (AmpliSens, Russia) in accordance with the manufacturer’s recommendations.

The amplification reaction was performed using the Master Mix BioMaster HS-Taq PCR (2×) reagent kit for endpoint PCR (Biolabmix, Russia) according to the manufacturer’s recommendations.

To differentiate between vaccine and field strains of the IBR virus, 8 pairs of primers presented in Table 1 were used according to the method of R.W. Fulton et al. (2013).

 

Table 1. Sequences of oligonucleotide primers recommended by R.W. Fulton et al. (2013) [7]

Таблица 1. Последовательности олигонуклеотидных праймеров, рекомендованные R.W. Fulton и соавт. (2013) [7]

It. numb.

№ п.п.

The target gene

Ген-мишень

Annealing direction

Направление отжига

Nucleotide sequence, 5’-3’

Нуклеотидная последовательность, 5’-3’

Fragment size, bp.

Размер фрагмента, п.н.

1

UL47A

Forward

Reverse

ACCACCCGCACCTCGTCA

CCGAGTCCGACAGAACCAGC

408

2

UL46B

Forward

Reverse

GGACCCCGAATCGGAACTG

AGCGACGTTACCCTCTCCACCTC

354

3

UL44

Forward

Reverse

CGCTCGCAGAGCATCCAC

ACCCGCCCGTTACCAACAG

169

4

UL41

Forward

Reverse

GCTCACGTACGGCCAGTTCC

TCGTGTCCACCACGTGCTTT

401

5

UL27

Forward

Reverse

CCCATGAAGGCGCTGTACCCGATCACCACG

GTTCCTGCCGTAGCTGCAGCACCAGCGACC

961

6

UL1

Forward

Reverse

ACGAGGGCACGATCCAATTTGAG

TACAGCGAGAGCGGCACCAG

340

7

UL6

Forward

Reverse

TGGCTTGCACTTGCCGGATCACG

GTTCCCCGTGATAAGGTACGCGGCA

494

8

107

Forward

Reverse

CGGCGCGGGAGTATATTTGC

TCGGCGCAAACTCCAGGCTAA

266

 

To differentiate between vaccine and field strains of the IBR virus, according to the method described by S.K. Chothe et al. (2018), three pairs of primers were used, as shown in Table 2.

 

Table 2. Sequences of oligonucleotide primers recommended by S.K. Chothe et al. (2018) [12]

Таблица 2. Последовательности олигонуклеотидных праймеров, рекомендованные S.K. Chothe и соавт. (2018) [12]

It. numb.

№ п.п.

The target gene

Ген-мишень

Annealing direction

Направление отжига

Nucleotide sequence, 5’-3’

Нуклеотидная последовательность, 5’-3’

Fragment size, bp.

Размер фрагмента, п.н.

1

UL19

Forward

Reverse

CTGTGTCCGGTGGACTTTC

CAGTAGCTGGTCACGCATT

212

2

UL9

Forward

Reverse

CACAACGTCTGCGTCTTCTC

ACCGTCGTGTAGATGAGCAC

161

3

UL47

Forward

Reverse

CAGCGCCGACGACTATGAT

GGGGAAACTGCTGCGCATA

230

 

Chothe и соавт. (2018) [12]

The DNA fragments obtained during amplification were analyzed by placing them in a 1% agarose gel. DNA fragments located at a specific distance from the start were cut out and isolated from the gel using the Lumiprobe kit (Russia). The same primers used for amplification were used for DNA fragment sequencing. Sanger sequencing was performed by Sintol LLC.

The obtained DNA sequences were analyzed using the Lasergene 11.1.0 software package (DNASTAR, USA). Multiple alignment was performed using ClustalW (BioEdit 7.2) and MUSCLE (MEGA 7.0.18) methods.

Results

Based on the amplification results obtained with each pair of primers recommended by R.W. Fulton et al. (2013) and bioinformatics analysis of the obtained nucleotide sequences, Table 3 was constructed.

 

Table 3. Generalized results of the R.W. Fulton et al. (2013) study

Таблица 3. Обобщенные результаты исследования по методу R.W. Fulton и соавт. (2013)

It. numb.

№ п.п.

Strain

Штамм

Position in the genome

Позиция в геноме

16378

17826

21893

22119

58792

58807

70426

99674

1

Cooper JX898220

G

T

C

A

T

T

T

T

2

Orenburg 1/70

G

C

C

3

GK/D

С

С

4

Zelenogradsky

5

МВА

G

C

C

6

4016

7

Т

 

G

C

C

8

Monarin

С

С

9

TK/А

10

Kuibyshev-2006

11

V-49

Note. «–» – nucleotide in the corresponding position corresponds to the nucleotide of the reference strain «Cooper JX898220».

Примечание. «–» – нуклеотид в соответствующем положении соответствует нуклеотиду референтного штамма «Cooper JX898220».

 

R.W. Fulton et al. (2013) proposed dividing strains and isolates of the IBR virus into four groups relative to the reference strain “Cooper JX898220” [7]:

Group 1. Characterized by single nucleotide substitutions at positions 2770, 17826, 26698, 57218, 58807, 90841, 100249, and 122396. This group mainly includes vaccine strains of the virus.

– Group 2. Single nucleotide substitutions were identified at positions 21893, 70999, and 96646 in the genome. This group includes both vaccine strains that differ from those in group 1 and field isolates isolated from animals with the respiratory form of IBR.

– Group 3. Single nucleotide substitutions were identified at positions 22119, 70246, 93332, and 99674 in the genome. R.W. Fulton et al. assigned field isolates of the virus isolated from aborted cows and aborted fetuses to this group.

Group 4. This group includes strains and isolates of the virus that did not fall into the first three groups. The main single nucleotide substitutions in viruses of this group have been identified in the genome regions encoding the UL52, UL13, UL0.7, etc. proteins. Group 4 mainly consists of field isolates of the virus isolated from animals with the respiratory form of IBR.

Based on the results of the studies, strains GK/D and Monarin were classified as group 1, strains T, Orenburg 1/70 and MBA as group 3, and strain TK/A and isolates Zelenogradsky, 4016, Kuibyshev-2006 and V-49 isolates were classified as group 4.

Based on the results of studies of the same 10 strains and isolates of the IBR virus using the method recommended by S.K. Chothe et al. (2018), 8 strains and isolates were classified as field strains, and the Monarin and GK/D strains were classified as vaccine strains based on the results of studies with the third pair of primers (Table 4).

 

Table 4. Generalized research results using the method of S.K. Chothe и соавт. (2018)

Таблица 4. Обобщенные результаты исследования по методу S.K. Chothe и соавт. (2018)

It. numb.

№ п.п.

Strain

Штамм

Position in the genome

Позиция в геноме

71822

86973

12360

1

Cooper JX898220

С

С

С

2

Orenburg 1/70

3

GK/D

T

4

Zeleonogradsky

5

МВА

6

4016

7

Т

8

Monarin

Т

9

TK/А

10

Kuibyshev-2006

11

V-49

Note. «–» – nucleotide in the corresponding position corresponds to the nucleotide of the reference strain «Cooper JX898220».

Примечание. «–» – нуклеотид в соответствующем положении соответствует нуклеотиду референтного штамма «Cooper JX898220».

 

To simplify the comparison of the results of differentiation of vaccine strains of the IBR virus from its vaccine strains using the methods of R.W. Fulton et al. (2013) and S.K. Chothe et al. (2018), a summary table was compiled summarizing data on single nucleotide substitutions in the genome positions of the reference strain “Cooper JX898220” recommended by the respective authors (Table 5).

 

Table 5. Interpretation of research results using the methods of R.W. Fulton et al. (2013) and S.K. Chothe et al. (2018)

Таблица 5. Интерпретация результатов исследований по методам R.W. Fulton и соавт. (2013 г.) и S.K. Chothe и соавт. (2018 г.).

Position in the genome

Позиция в геноме

Nucleotide of the Cooper strain JX898220

Нуклеотид реф. штамма «Cooper JX898220»

Single nucleotide substitutions

Однонуклеотидные замены

group 1 (vaccine strains)

группа 1 (вакцинные штаммы)

group 2 (vaccine strains and some field isolates from respiratory organs)

группа 2 (вакцинные штаммы и некоторые полевые изоляты из респираторных органов)

group 3 (field isolates from aborted fetuses)

группа 3 (полевые изоляты от абортированных плодов)

group 4 (field isolates from respiratory organs)

группа 4 (полевые изоляты из респираторных органов)

According to the method of R.W. Fulton et al. (2013)

По методу R.W. Fulton и соавт. (2013 г.)

16378

C

A

17826

T

C

21893

C

T

22119

A

G

58792

T

G

58807

T

C

70426

T

C

99674

T

C

According to the method of Chothe S.K. et al. (2018)

По методу Chothe S.K. и соавт. (2018 г.)

12360

C

T

71822

C

T

T

86973

C

T

Note. «–» – nucleotide in the corresponding position corresponds to the nucleotide of the reference strain «Cooper JX898220».

Примечание. «–» – нуклеотид в соответствующем положении соответствует нуклеотиду референтного штамма «Cooper JX898220».

 

Discussion

The results obtained, presented in Tables 3, 4, and 5, experimentally confirmed the origin of the studied strains and isolates of the IBR virus.

The GK/D and Monarin strains were obtained from live attenuated vaccines manufactured abroad. However, the Bovilis IBR Marker live vaccine, Unisolve (Intervet International B.V., Netherlands) was not studied by R.W. Fulton et al. (2013) nor by S.K. and Chothe et al. (2018), therefore there is no data in the available literature on the classification of this strain into one of the four groups described. Nevertheless, since we isolated this virus strain ourselves from a commercial batch of vaccine, there is no doubt about its origin, and based on the results of our molecular genetic studies, this virus strain is classified in group 1 – vaccine strains.

The origin of the Monarin strain has not been fully clarified, but it is known that it was isolated by employees of the virology laboratory of the Moscow Veterinary Academy in the 1980s from a live vaccine produced abroad. There is no more precise data on the origin of this strain in the archival documents. Our research confirms the historical origin of this strain as a vaccine strain.

The vaccine strain “T”, which is currently used for the production of a series of inactivated vaccines, and the reference strains “Orenburg 1/70” and “MBA”, according to the results of molecular genetic studies, are classified in group 3 (field isolates from aborted fetuses). According to archival documents, the Orenburg 1/70 strain was isolated in 1970 on a farm in the Orenburg region by staff of the virology laboratory of the Moscow Veterinary Academy from the nasal mucus of cattle. The MBA strain was obtained by employees of the same laboratory from the tissues of aborted fetuses delivered from a farm in the Moscow region.

When studying the Zelenogradsky, 4016, Kuibyshev-2006, TK/A, and V-49 strains, no single nucleotide substitutions were detected at the 11 control points indicated in Tables 3 and 4. According to R.W. Fulton et al. (2013), in such cases, strains and isolates of the IBR virus should be classified as group 4 (field isolates from respiratory organs). However, given the history of the origin of these five strains and isolates, only three of them – 4016, Kuibyshev-2006 and V-49 – can be attributed to the VB1 virus, as they were actually isolated at different times from bovine nasal mucus material.

The TK/A and Zelenogradsky strains are representatives of bovine herpesvirus type 5 (Varicellovirus bovinealpha5). We introduced these strains into the study to investigate the possible presence of single nucleotide substitutions at control points in the genome recommended by R.W. Fulton et al. (2013) and S.K. Chothe et al. (2018) to determine the possibility of differentiating bovine herpesviruses types 1 and 5 when identifying such substitutions. Based on the results of reviewing 11 control points of the genome recommended by American colleagues, both of these strains were classified as herpesvirus VB1 group 4. Only with a more detailed bioinformatics analysis of these strains at other control points for the localization of single nucleotide substitutions indicated by R.W. Fulton et al. (2013) were nucleotide substitutions established at positions: 70217, 70241, 70250, 70271, 70289, 70292, 70334, 70343, 70351, 70362, 70376, 70379, 70442, 70463, and 70502. The presence of such substitutions, which can only be established by additional molecular genetic studies, does not allow these strains to be classified into any of the four groups described above and confirms their unique position in relation to other strains and isolates featured in this study.

Conclusion

Both methods confirmed that local strains of the IBR virus currently used for the production of inactivated vaccines originate from field isolates of this virus. At the same time, both the reference and modern epizootic isolates obtained by us and our colleagues at different times in Russia are epizootic strains that are not directly related to the large-scale use of foreign vaccines, including live vaccines, both among native livestock and among animals imported from abroad.

Nevertheless, none of the methods we tested allows us to differentiate between bovine herpesviruses types 1 and 5. This feature can lead to diagnostic errors, especially if the initial biological material for detecting the genetic material of the virus is obtained from the upper respiratory tract of the animal. To solve this problem, we recommend the multiplex PCR we have developed for the detection and differentiation of these two types of bovine herpesvirus3.

1 A method for detecting the cattle IRT virus in a polymerase chain reaction followed by differentiation of the TK-A vaccine strain from epizootic strains and isolates using PDRF analysis. Patent RF № 2265667; 2003. (in Russian)

2 The State Register of medicines for veterinary use. Available at: https://galen.vetrf.ru/#/registry/pharm/registry?page=1 (in Russian)

3 A set of oligonucleotide primers and fluorescently labeled probes for the identification and differentiation of DNA of bovine herpesviruses of types 1 and 5. Patent RF № 2837794 C1; 2024. (in Russian)

×

About the authors

Alexander V. Pchelnikov

Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin

Email: vetdr-mom@list.ru
ORCID iD: 0000-0002-9712-3079

Doctor of Veterinary Sciences, Associate Professor, Associate Professor of the Department of Epizootology and Organization of Veterinary Medicine

Russian Federation, 109472, Moscow

Anton G. Yuzhakov

Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin

Email: anton_oskol@mail.ru
ORCID iD: 0000-0002-0426-9678

Candidate of Biological Sciences, Senior Researcher at the Interdepartmental Research Laboratory

Russian Federation, 109472, Moscow

Irina A. Makhova

Moscow State Academy of Veterinary Medicine and Biotechnology – MVA named after K.I. Skryabin

Author for correspondence.
Email: makhovairinafvm@yandex.ru
ORCID iD: 0009-0008-1851-8963

Laboratory assistant at the Interdepartmental Research Laboratory

Russian Federation, 109472, Moscow

References

  1. Mayfield J.E., Good P.J., VanOort H.J., Campbell A.R., Reed D.E. Cloning and cleavage site mapping of DNA from bovine herpesvirus 1 (Cooper strain). J. Virol. 1983; 47(1): 259–64. https://doi.org/10.1128/JVI.47.1.259-264.1983
  2. Baumeister J., Klupp B.G., Mettenleiter T.C. Pseudorabies virus and equine herpesvirus 1 share a nonessential gene which is absent in other herpesviruses and located adjacent to a highly conserved gene cluster. J. Virol. 1995; 69(9): 5560–7. https://doi.org/10.1128/JVI.69.9.5560-5567.1995
  3. Henderson G., Zhang Y., Inman M., Jones D., Jones C. Infected cell protein 0 encoded by bovine herpesvirus 1 can activate caspase 3 when overexpressed in transfected cells. J. Gen. Virol. 2004; 85(Pt. 12): 3511–6. https://doi.org/10.1099/vir.0.80371-0
  4. Inman M., Zhou J., Webb H., Jones C. Identification of a novel bovine herpesvirus 1 transcript containing a small open reading frame that is expressed in trigeminal ganglia of latently infected cattle. J. Virol. 2004; 78(10): 5438–47. https://doi.org/10.1128/jvi.78.10.5438-5447.2004
  5. Lipińska A.D., Koppers-Lalic D., Rychłowski M., Admiraal P., Rijsewijk F.A., Bieńkowska-Szewczyk K., et al. Bovine herpesvirus 1 UL49.5 protein inhibits the transporter associated with antigen processing despite complex formation with glycoprotein M. J. Virol. 2006; 80(12): 5822–32. https://doi.org/10.1128/JVI.02707-05
  6. Winkler M.T., Doster A., Jones C. Persistence and reactivation of bovine herpesvirus 1 in the tonsils of latently infected calves. J. Virol. 2000; 74(11): 5337–46. https://doi.org/10.1128/jvi.74.11.5337-5346.2000
  7. Fulton R.W., d’Offay J.M., Eberle R. Bovine herpesvirus-1: comparison and differentiation of vaccine and field strains based on genomic sequence variation. Vaccine. 2013; 31(11): 1471–9. https://doi.org/10.1016/j.vaccine.2013.01.013
  8. Fulton R.W., d’Offay J.M., Dubovi E.J., Eberle R. Bovine herpesvirus-1: Genetic diversity of field strains from cattle with respiratory disease, genital, fetal disease and systemic neonatal disease and their relationship to vaccine strains. Virus Res. 2016; 223: 115–21. https://doi.org/10.1016/j.virusres.2016.06.017
  9. Fulton R.W., d’Offay J.M., Eberle R., Moeller R.B., Campen H.V., O’Toole D., et al. Bovine herpesvirus-1: evaluation of genetic diversity of subtypes derived from field strains of varied clinical syndromes and their relationship to vaccine strains. Vaccine. 2015; 33(4): 549–58. https://doi.org/10.1016/j.vaccine.2014.11.033
  10. Fulton R.W., d’Offay J.M., Landis C., Miles D.G., Smith R.A., Saliki J.T., et al. Detection and characterization of viruses as field and vaccine strains in feedlot cattle with bovine respiratory disease. Vaccine. 2016; 34(30): 3478–92. https://doi.org/10.1016/j.vaccine.2016.04.020
  11. Chase C.C.L., Fulton R.W., O’Toole D., Gillette B., Daly R.F., Perry G., et al. Bovine herpesvirus 1 modified live virus vaccines for cattle reproduction: Balancing protection with undesired effects. Vet. Microbiol. 2017; 206: 69–77. https://doi.org/10.1016/j.vetmic.2017.03.016
  12. Chothe S.K., Sebastian A., Thomas A., Nissly R.H., Wolfgang D., Byukusenge M., et al. Whole-genome sequence analysis reveals unique SNP profiles to distinguish vaccine and wild-type strains of bovine herpesvirus-1 (BoHV-1). Virology. 2018; 522: 27–36. https://doi.org/10.1016/j.virol.2018.06.015
  13. Pchelnikov, A.V. Improvement and development of methods for the diagnosis and prevention of herpesvirus diseases in cattle: specialty 4.2.3. Infectious diseases and animal immunology: abstract of the dissertation for the degree of Doctor of Veterinary Sciences / Pchelnikov Alexander Vladimirovich. – Moscow, 2025. – 34 p.

Supplementary files

Supplementary Files
Action
1. JATS XML

Copyright (c) 2025 Pchelnikov A.V., Yuzhakov A.G., Makhova I.A.

Creative Commons License
This work is licensed under a Creative Commons Attribution 4.0 International License.

СМИ зарегистрировано Федеральной службой по надзору в сфере связи, информационных технологий и массовых коммуникаций (Роскомнадзор).
Регистрационный номер и дата принятия решения о регистрации СМИ: серия ПИ № ФС77-77676 от 29.01.2020.